/* Minification failed. Returning unminified contents.
(6092,5): run-time error CSS1062: Expected semicolon or closing curly-brace, found '-'
(9636,32): run-time error CSS1030: Expected identifier, found ','
(9636,57): run-time error CSS1031: Expected selector, found ')'
(9636,57): run-time error CSS1025: Expected comma or open brace, found ')'
(9639,32): run-time error CSS1030: Expected identifier, found ','
(9639,57): run-time error CSS1031: Expected selector, found ')'
(9639,57): run-time error CSS1025: Expected comma or open brace, found ')'
(12400,26): run-time error CSS1030: Expected identifier, found ','
(12400,53): run-time error CSS1031: Expected selector, found ')'
(12400,53): run-time error CSS1025: Expected comma or open brace, found ')'
(12786,131): run-time error CSS1030: Expected identifier, found ','
(12786,150): run-time error CSS1031: Expected selector, found ')'
(12786,150): run-time error CSS1025: Expected comma or open brace, found ')'
(16649,26): run-time error CSS1030: Expected identifier, found ','
(16649,53): run-time error CSS1031: Expected selector, found ')'
(16649,53): run-time error CSS1025: Expected comma or open brace, found ')'
 */

        .input-group.questions input.form-control + span.input-group-addon i {
            cursor: pointer;
        }

.loading-overlay-showing > .loading-overlay {
    z-index: 10009;
}

.table.sub > tbody > tr:first-child > td {
    border-top: 0 !important;
}

table.table-container {
    border-spacing: 0;
    border-collapse: collapse;
    width: 100%;
}

    table.table-container tbody {
        display: table-row-group;
        vertical-align: middle;
        border-color: inherit;
    }

        table.table-container tbody .name-text {
            width: 100%;
            text-align: left;
        }


        table.table-container tbody .form-control.description {
            border-radius: 0 4px 4px 0 !important;
            -webkit-border-radius: 0 4px 4px 0 !important;
        }

        table.table-container tbody .spinner-input {
            width: 60px;
            border-bottom-left-radius: 0;
            border-top-left-radius: 0;
            border-left: 0;
        }

    table.table-container tr {
        display: table-row;
        vertical-align: inherit;
        border-color: inherit;
    }

    table.table-container td.options {
        padding-left: 0;
        box-sizing: border-box;
        width: 66px;
        padding: 4px 4px 8px 14px;
        vertical-align: top;
    }


.nav-tabs.nav-justified.linear li:first-child a,
.nav-tabs.nav-justified.linear li:first-child a:hover {
    border-top-left-radius: 0;
}


.nav-tabs.nav-justified.linear li:last-child a,
.nav-tabs.nav-justified.linear li:last-child a:hover {
    border-top-right-radius: 0;
}



.hide-text {
    font: 0/0 a;
    color: transparent;
    text-shadow: none;
    background-color: transparent;
    border: 0;
}

.input-block-level {
    display: block;
    width: 100%;
    min-height: 30px;
    -webkit-box-sizing: border-box;
    -moz-box-sizing: border-box;
    box-sizing: border-box;
}

.btn-file {
    overflow: hidden;
    position: relative;
    vertical-align: middle;
}

    .btn-file > input {
        position: absolute;
        top: 0;
        right: 0;
        margin: 0;
        opacity: 0;
        filter: alpha(opacity=0);
        transform: translate(-300px, 0) scale(4);
        font-size: 23px;
        direction: ltr;
        cursor: pointer;
    }



.fileupload {
    margin-bottom: 9px;
}

    .fileupload .uneditable-input {
        display: inline-block;
        margin-bottom: 0px;
        vertical-align: middle;
        cursor: text;
    }

    .fileupload .thumbnail {
        overflow: hidden;
        display: inline-block;
        margin-bottom: 5px;
        vertical-align: middle;
        text-align: center;
    }

        .fileupload .thumbnail > img {
            display: inline-block;
            vertical-align: middle;
            max-height: 100%;
        }

    .fileupload .btn {
        vertical-align: middle;
    }


.fileupload-exists .fileupload-new,
.fileupload-new .fileupload-exists {
    display: none;
}

.fileupload-inline .fileupload-controls {
    display: inline;
}

.fileupload-new .input-append .btn-file {
    -webkit-border-radius: 0 3px 3px 0;
    -moz-border-radius: 0 3px 3px 0;
    border-radius: 0 3px 3px 0;
}

.thumbnail-borderless .thumbnail {
    border: none;
    padding: 0;
    -webkit-border-radius: 0;
    -moz-border-radius: 0;
    border-radius: 0;
    -webkit-box-shadow: none;
    -moz-box-shadow: none;
    box-shadow: none;
}

.fileupload-new.thumbnail-borderless .thumbnail {
    border: 1px solid #ddd;
}

.control-group.warning .fileupload .uneditable-input {
    color: #a47e3c;
    border-color: #a47e3c;
}

.control-group.warning .fileupload .fileupload-preview {
    color: #a47e3c;
}

.control-group.warning .fileupload .thumbnail {
    border-color: #a47e3c;
}

.control-group.error .fileupload .uneditable-input {
    color: #b94a48;
    border-color: #b94a48;
}

.control-group.error .fileupload .fileupload-preview {
    color: #b94a48;
}

.control-group.error .fileupload .thumbnail {
    border-color: #b94a48;
}

.control-group.success .fileupload .uneditable-input {
    color: #468847;
    border-color: #468847;
}

.control-group.success .fileupload .fileupload-preview {
    color: #468847;
}

.control-group.success .fileupload .thumbnail {
    border-color: #468847;
}


.fileinput-button {
    position: relative;
    overflow: hidden;
    display: inline-block;
}

    .fileinput-button input {
        position: absolute;
        top: 0;
        right: 0;
        margin: 0;
        opacity: 0;
        -ms-filter: 'alpha(opacity=0)';
        font-size: 200px;
        direction: ltr;
        cursor: pointer;
        max-height: 80px !important;
    }

/* Fixes for IE < 8 */
@media screen\9 {
    .fileinput-button input {
        filter: alpha(opacity=0);
        font-size: 100%;
        height: 100%;
    }
}

/*--------End file upload-------------*/


/* Thumb Info */
.thumb-info {
    display: block;
    position: relative;
    text-decoration: none;
    max-width: 100%;
    background-color: #FFF;
    border: 1px solid #DDD;
    border-radius: 4px;
    overflow: hidden;
    -webkit-backface-visibility: hidden;
    -moz-backface-visibility: hidden;
    backface-visibility: hidden;
    -webkit-transform: translate3d(0, 0, 0);
    -moz-transform: translate3d(0, 0, 0);
    transform: translate3d(0, 0, 0);
}

    .thumb-info .thumb-info-wrapper {
        -webkit-backface-visibility: hidden;
        -moz-backface-visibility: hidden;
        backface-visibility: hidden;
        -webkit-transform: translate3d(0, 0, 0);
        -moz-transform: translate3d(0, 0, 0);
        transform: translate3d(0, 0, 0);
        border-radius: 4px;
        margin: 4px;
        overflow: hidden;
        display: block;
        position: relative;
    }

        .thumb-info .thumb-info-wrapper:after {
            content: "";
            background: rgba(23, 23, 23, 0.8);
            -webkit-transition: all 0.3s;
            -moz-transition: all 0.3s;
            transition: all 0.3s;
            border-radius: 4px;
            bottom: -4px;
            color: #FFF;
            left: -4px;
            position: absolute;
            right: -4px;
            top: -4px;
            display: block;
            opacity: 0;
            z-index: 1;
        }

    .thumb-info .thumb-info-action-icon {
        -webkit-transition: all 0.3s;
        -moz-transition: all 0.3s;
        transition: all 0.3s;
        background: #CCC;
        border-radius: 0 0 0 25px;
        display: inline-block;
        font-size: 25px;
        height: 50px;
        line-height: 50px;
        position: absolute;
        right: -100px;
        text-align: center;
        top: -100px;
        width: 50px;
        z-index: 2;
    }

        .thumb-info .thumb-info-action-icon i {
            font-size: 24px;
            left: 3px;
            position: relative;
            top: -4px;
            color: #FFF;
        }

    .thumb-info .thumb-info-inner {
        -webkit-transition: all 0.3s;
        -moz-transition: all 0.3s;
        transition: all 0.3s;
        display: block;
    }

        .thumb-info .thumb-info-inner em {
            display: block;
            font-size: 0.8em;
            font-style: normal;
            font-weight: normal;
        }

    .thumb-info .thumb-info-title {
        padding: 0 10px 7px;
    }

    .thumb-info .thumb-info-type {
        background-color: #CCC;
        border-radius: 2px;
        display: inline-block;
        float: left;
        font-size: 12px;
        font-weight: 400;
        letter-spacing: 0;
        margin: 8px -2px -15px -2px;
        padding: 2px 9px;
        text-transform: none;
        z-index: 2;
    }

    .thumb-info .owl-carousel {
        z-index: auto;
    }

        .thumb-info .owl-carousel .owl-dots {
            z-index: 2;
        }

    .thumb-info img {
        -webkit-transition: all 0.3s ease;
        -moz-transition: all 0.3s ease;
        transition: all 0.3s ease;
        border-radius: 3px;
        position: relative;
        width: 100%;
    }





        .thumb-info img.resize {
            position: relative;
            width: 100%;
            height: 150px;
            background-position: 50% 50%;
            background-repeat: no-repeat;
            -ms-background-size: cover;
            background-size: cover;
        }


@media only screen and (min-width: 320px) and (max-width: 479px) {
    .thumb-info img.resize {
        height: 180px;
    }
}

@media only screen and (min-width: 480px) and (max-width: 767px) {
    .thumb-info img.resize {
        height: 280px;
    }
}

@media only screen and (min-width: 768px) and (max-width: 991px) {
    .thumb-info img.resize {
        height: 220px;
    }
}

@media only screen and (min-width: 992px) and (max-width: 1999px) {
    .thumb-info img.resize {
        height: 150px;
    }
}


.thumb-info:hover .thumb-info-wrapper:after {
    opacity: 1;
}

.thumb-info:hover .thumb-info-action-icon {
    right: 0;
    top: 0;
}

.thumb-info:hover .thumb-info-title {
    background: #000;
}

.thumb-info:hover img {
    -webkit-transform: scale(1.1, 1.1);
    -moz-transform: scale(1.1, 1.1);
    -ms-transform: scale(1.1, 1.1);
    -o-transform: scale(1.1, 1.1);
    transform: scale(1.1, 1.1);
}

.thumb-info.thumb-info-no-zoom img {
    -webkit-transition: initial;
    -moz-transition: initial;
    transition: initial;
}

.thumb-info.thumb-info-no-zoom:hover img {
    -webkit-transform: scale(1, 1);
    -moz-transform: scale(1, 1);
    -ms-transform: scale(1, 1);
    -o-transform: scale(1, 1);
    transform: scale(1, 1);
}

.thumb-info.thumb-info-lighten .thumb-info-wrapper:after {
    background: rgba(23, 23, 23, 0.25);
}

.thumb-info.thumb-info-hide-wrapper-bg .thumb-info-wrapper:after {
    display: none;
}

.thumb-info.thumb-info-centered-icons .thumb-info-action {
    -webkit-transition: -webkit-transform 0.2s ease-out, opacity 0.2s ease-out;
    -moz-transition: -moz-transform 0.2s ease-out, opacity 0.2s ease-out;
    transition: transform 0.2s ease-out, opacity 0.2s ease-out;
    transform: translate3d(0, -10px, 0);
    top: 50%;
    left: 3px;
    right: auto;
    bottom: auto;
    width: 100%;
    height: 40px;
    margin-top: -20px;
    text-align: center;
    position: absolute;
    opacity: 0;
    z-index: 2;
}

.thumb-info.thumb-info-centered-icons .thumb-info-action-icon {
    -webkit-transition: all 0.1s ease;
    -moz-transition: all 0.1s ease;
    transition: all 0.1s ease;
    position: relative;
    z-index: 2;
    left: auto;
    right: auto;
    top: auto;
    bottom: auto;
    width: 40px;
    height: 40px;
    line-height: 33px;
    border-radius: 50%;
    margin-right: 3px;
}

    .thumb-info.thumb-info-centered-icons .thumb-info-action-icon i {
        position: static;
        font-size: 18px;
    }

    .thumb-info.thumb-info-centered-icons .thumb-info-action-icon:hover {
        -webkit-transform: scale(1.15, 1.15);
        -moz-transform: scale(1.15, 1.15);
        -ms-transform: scale(1.15, 1.15);
        -o-transform: scale(1.15, 1.15);
        transform: scale(1.15, 1.15);
    }

.thumb-info:hover.thumb-info-centered-icons .thumb-info-action {
    transform: translate3d(0, 0, 0);
    opacity: 1;
}

.thumb-info:hover.thumb-info-centered-icons .thumb-info-action-icon {
    position: relative;
}

.thumb-info.thumb-info-centered-info .thumb-info-title {
    background: transparent;
    left: 5%;
    width: 90%;
    -webkit-transition: -webkit-transform 0.2s ease-out, opacity 0.2s ease-out;
    -moz-transition: -moz-transform 0.2s ease-out, opacity 0.2s ease-out;
    transition: transform 0.2s ease-out, opacity 0.2s ease-out;
    transform: translate(0%, -30%);
    top: 50%;
    bottom: auto;
    opacity: 0;
    text-align: center;
    padding: 0;
    position: absolute;
}

.thumb-info.thumb-info-centered-info .thumb-info-type {
    float: none;
}

.thumb-info.thumb-info-centered-info:hover .thumb-info-title {
    opacity: 1;
    transform: translate(0%, -50%);
}

.thumb-info.thumb-info-bottom-info .thumb-info-title {
    background: #FFF;
    left: 0;
    width: 100%;
    max-width: 100%;
    -webkit-transition: -webkit-transform 0.2s ease-out, opacity 0.2s ease-out;
    -moz-transition: -moz-transform 0.2s ease-out, opacity 0.2s ease-out;
    transition: transform 0.2s ease-out, opacity 0.2s ease-out;
    transform: translate3d(0, 100px, 0);
    top: auto;
    bottom: 0;
    opacity: 0;
    padding: 15px;
    text-shadow: none;
    color: #777;
}

.thumb-info.thumb-info-bottom-info .thumb-info-type {
    float: none;
    background: none;
    padding: 0;
    margin: 0;
}

.thumb-info.thumb-info-bottom-info .thumb-info-title {
    transform: translate3d(0, 0, 0);
    opacity: 1;
}

/*.thumb-info.thumb-info-bottom-info:hover img {
        -webkit-transform: translateY(-18px);
        -moz-transform: translateY(-18px);
        -ms-transform: translateY(-18px);
        -o-transform: translateY(-18px);
        transform: translateY(-18px);
    }*/

.thumb-info.thumb-info-bottom-info-dark .thumb-info-title {
    background: -webkit-linear-gradient( bottom, rgba(23, 23, 23, 0.8) 0, transparent 100%) repeat scroll 0 0 transparent;
    background: linear-gradient(to top, rgba(23, 23, 23, 0.8) 0, transparent 100%) repeat scroll 0 0 transparent;
    color: #FFF;
}

.thumb-info.thumb-info-push-hor img {
    -webkit-transform: translatex(-18px);
    -moz-transform: translatex(-18px);
    -ms-transform: translatex(-18px);
    -o-transform: translatex(-18px);
    transform: translatex(-18px);
    width: calc(100% + 19px);
    max-width: none;
}

.thumb-info.thumb-info-push-hor:hover img {
    -webkit-transform: translatex(0);
    -moz-transform: translatex(0);
    -ms-transform: translatex(0);
    -o-transform: translatex(0);
    transform: translatex(0);
}

.thumb-info.thumb-info-hide-info-hover .thumb-info-wrapper:after {
    opacity: 0.65;
}

.thumb-info.thumb-info-hide-info-hover .thumb-info-title {
    opacity: 1;
    top: 50%;
}

.thumb-info.thumb-info-hide-info-hover .thumb-info-type {
    float: none;
}

.thumb-info.thumb-info-hide-info-hover:hover .thumb-info-wrapper:after {
    opacity: 0.1;
}

.thumb-info.thumb-info-hide-info-hover:hover .thumb-info-title {
    opacity: 0;
}

.thumb-info.thumb-info-no-borders, .thumb-info.thumb-info-no-borders img {
    border: 0;
    padding: 0;
    margin: 0;
    border-radius: 0;
}

    .thumb-info.thumb-info-no-borders .thumb-info-wrapper {
        border: 0;
        padding: 0;
        margin: 0;
        border-radius: 0;
    }

        .thumb-info.thumb-info-no-borders .thumb-info-wrapper:after {
            border-radius: 0;
            bottom: 0;
            left: 0;
            right: 0;
            top: 0;
        }

.thumb-info.thumb-info-preview .thumb-info-wrapper:after {
    display: none;
}

.thumb-info.thumb-info-preview .thumb-info-image {
    min-height: 232px;
    display: block;
    background-position: center top;
    background-repeat: no-repeat;
    background-size: 100% auto;
    position: relative;
    transition: background-position 0.8s linear 0s;
}

.thumb-info.thumb-info-preview:hover .thumb-info-image {
    transition: background-position 2.5s linear 0s;
    background-position: center bottom;
}

.thumb-info.thumb-info-preview.thumb-info-preview-short:hover .thumb-info-image {
    transition: background-position 1s linear 0s;
}

.thumb-info.thumb-info-preview.thumb-info-preview-long:hover .thumb-info-image {
    transition: background-position 5s linear 0s;
}

html.webkit .thumb-info .thumb-info-wrapper {
    margin: 4px 4px 3px 4px;
}

html.webkit .full-width .thumb-info .thumb-info-wrapper,
html.webkit .masonry-item .thumb-info .thumb-info-wrapper,
html.webkit .thumb-info-no-borders .thumb-info-wrapper {
    margin: 0;
}


/* Thumb Info Ribbon */
.thumb-info-ribbon {
    background: #999;
    position: absolute;
    margin: -16px 0 0 0;
    padding: 5px 13px 6px;
    right: 15px;
    z-index: 1;
}

    .thumb-info-ribbon:before {
        border-right: 10px solid #646464;
        border-top: 16px solid transparent;
        content: "";
        display: block;
        height: 0;
        left: -10px;
        position: absolute;
        top: 0;
        width: 7px;
    }

    .thumb-info-ribbon span {
        color: #FFF;
        font-size: 1.1em;
        font-family: "Shadows Into Light", cursive;
    }

.span-text {
    cursor: pointer;
}

/* Thumb Info - Full Width */
.full-width .thumb-info img {
    border-radius: 0 !important;
}

/* Thumb Info Caption	*/
.thumb-info-caption {
    padding: 10px 0;
}

    .thumb-info-caption .thumb-info-caption-text, .thumb-info-caption p {
        font-size: 0.9em;
        line-height: 20px;
        margin: 0 0 8px;
        padding: 10px;
        display: block;
    }

/* Thumb Info Side Image	*/
.thumb-info-side-image .thumb-info-side-image-wrapper {
    padding: 4px;
    float: left;
    margin-right: 20px;
}

.thumb-info-side-image .thumb-info-caption .thumb-info-caption-text {
    padding: 17px;
}

.thumb-info-side-image-right .thumb-info-side-image-wrapper {
    float: right;
    margin-left: 20px;
    margin-right: 0;
}

/* Thumb Info Social Icons */
.thumb-info-social-icons {
    border-top: 1px dotted #DDD;
    margin: 0;
    padding: 15px 10px;
    display: block;
}

    .thumb-info-social-icons a.icons {
        background: #CCC;
        border-radius: 25px;
        display: inline-block;
        height: 30px;
        line-height: 30px;
        text-align: center;
        width: 30px;
    }

    .thumb-info-social-icons a:hover {
        text-decoration: none;
    }

    .thumb-info-social-icons a span {
        display: none;
    }

    .thumb-info-social-icons a i {
        color: #FFF;
        font-size: 0.9em;
        font-weight: normal;
    }

/* Responsive */
@media (max-width: 991px) {
    .thumb-info .thumb-info-title {
        font-size: 14px;
    }

    .thumb-info .thumb-info-more {
        font-size: 11px;
    }
}



/* Tabs  */
/* Center */
.tabs-center .nav-tabs {
    margin: 0 auto;
    text-align: center;
}
.tabs-center .nav-tabs-left {
    margin: 0 auto;
    text-align: left;
}



/* Simple */

.tabs.tabs-simple {
    margin-bottom: 0px;
}

    .tabs.tabs-simple .nav-tabs {
        border: 0;
        /*margin-bottom: 10px;*/
    }

        .tabs.tabs-simple .nav-tabs > li {
            margin-left: 0;
            /*margin-bottom: 20px;*/
        }


            .tabs.tabs-simple .nav-tabs > li a, .tabs.tabs-simple .nav-tabs > li a:hover, .tabs.tabs-simple .nav-tabs > li a:focus {
                padding: 15px 30px;
                background: none;
                border: 0;
                border-bottom: 3px solid #eee;
                border-radius: 0;
                color: #777;
                font-size: 16px;
            }

    .tabs.tabs-simple .tab-content {
        background: transparent;
        border: 0;
        padding: 0;
        margin: 0;
        box-shadow: none;
    }


.tabs.tabs-bottom.tabs-center.tabs-simple .nav.nav-tabs.nav-justified li a {
    padding: 15px;
}


.tabs.tabs-bottom.tabs-simple .nav.nav-tabs.nav-justified li:first-child a,
.tabs.tabs-bottom.tabs-simple .nav.nav-tabs.nav-justified li:last-child a {
    border-radius: 0px;
}


/* Icon Featured */
.icon-featured {
    display: inline-block;
    font-size: 0;
    /*margin: 15px;*/
    width: 110px;
    height: 110px;
    border-radius: 50%;
    text-align: center;
    position: relative;
    z-index: 1;
    color: #FFF;
    font-size: 40px;
    line-height: 110px;
}

    .icon-featured:after {
        pointer-events: none;
        position: absolute;
        width: 100%;
        height: 100%;
        border-radius: 50%;
        content: '';
        -webkit-box-sizing: content-box;
        -moz-box-sizing: content-box;
        box-sizing: content-box;
    }


/* Featured Box */
.featured-box {
    background: #F5F5F5;
    background: -webkit-linear-gradient( top, #FFF 1%, #fcfcfc 98%) repeat scroll 0 0 transparent;
    background: linear-gradient(to bottom, #FFF 1%, #fcfcfc 98%) repeat scroll 0 0 transparent;
    -webkit-box-sizing: border-box;
    -moz-box-sizing: border-box;
    box-sizing: border-box;
    border-bottom: 1px solid #DFDFDF;
    border-left: 1px solid #ECECEC;
    border-radius: 8px;
    border-right: 1px solid #ECECEC;
    box-shadow: 0 1px 1px 0 rgba(0, 0, 0, 0.04);
    margin-bottom: 20px;
    margin-left: auto;
    margin-right: auto;
    margin-top: 20px;
    min-height: 100px;
    position: relative;
    text-align: center;
    z-index: 1;
}

    .featured-box h4 {
        font-size: 1.3em;
        font-weight: 400;
        letter-spacing: -0.7px;
        margin-top: 5px;
        margin-bottom: 5px;
    }

    .featured-box .box-content {
        border-radius: 8px;
        border-top: 1px solid #CCC;
        border-top-width: 4px;
        /*padding: 15px 15px 5px 15px;*/
        padding: 0;
        position: relative;
        top: -1px;
    }

    .featured-box .learn-more {
        display: block;
        margin-top: 10px;
    }

/* Featured Box Left */
.featured-box-text-left {
    text-align: left;
}

/* Featured Boxes - Flat */
.featured-boxes-flat .featured-box {
    box-shadow: none;
    margin: 10px 0;
}

    .featured-boxes-flat .featured-box .box-content {
        background: #FFF;
        margin-top: 65px;
    }

    .featured-boxes-flat .featured-box .icon-featured {
        display: inline-block;
        font-size: 38px;
        height: 90px;
        line-height: 90px;
        padding: 0;
        width: 90px;
        margin: -100px 0 -15px;
        position: relative;
        top: -37px;
    }

/* Featured Boxes - Style 2 */
.featured-boxes-style-2 .featured-box {
    background: none;
    border: 0;
    margin: 10px 0;
    box-shadow: none;
}

    .featured-boxes-style-2 .featured-box .box-content {
        border: 0;
        padding-top: 0;
        padding-bottom: 0;
    }

    .featured-boxes-style-2 .featured-box .icon-featured {
        display: inline-block;
        font-size: 30px;
        height: 75px;
        line-height: 75px;
        padding: 0;
        width: 75px;
        margin-top: 15px;
        cursor: pointer;
    }

/* Featured Boxes - Style 3 */
.featured-boxes-style-3 .featured-box {
    margin: 10px 0;
}

    .featured-boxes-style-3 .featured-box .icon-featured {
        display: inline-block;
        font-size: 30px;
        height: 75px;
        line-height: 75px;
        padding: 0;
        width: 75px;
        margin-top: -10px;
        background: #FFF;
        border: 3px solid #CCC;
        color: #CCC;
        line-height: 68px;
        cursor: pointer;
    }

.featured-boxes-style-3:not(.featured-boxes-flat) .featured-box {
    background: none;
    border: 0;
    box-shadow: none;
}

    .featured-boxes-style-3:not(.featured-boxes-flat) .featured-box .box-content {
        border: 0;
        padding-top: 0;
        padding-bottom: 0;
    }

/* Featured Boxes - Style 4 */
.featured-boxes-style-4 .featured-box {
    background: none;
    border: 0;
    margin: 10px 0;
    box-shadow: none;
}

    .featured-boxes-style-4 .featured-box .box-content {
        border: 0;
        padding-top: 0;
        padding-bottom: 0;
    }

    .featured-boxes-style-4 .featured-box .icon-featured {
        display: inline-block;
        font-size: 40px;
        height: 45px;
        line-height: 45px;
        padding: 0;
        width: 45px;
        margin-top: 0;
        margin-bottom: 10px;
        background: transparent;
        color: #CCC;
        border-radius: 0;
    }

/* Featured Boxes - Style 5, 6 and 7 */
.featured-boxes-style-5 .featured-box, .featured-boxes-style-6 .featured-box, .featured-boxes-style-7 .featured-box {
    background: none;
    border: 0;
    box-shadow: none;
    margin: 10px 0;
}

    .featured-boxes-style-5 .featured-box .box-content, .featured-boxes-style-6 .featured-box .box-content, .featured-boxes-style-7 .featured-box .box-content {
        border: 0;
        padding-top: 0;
        padding-bottom: 0;
    }

        .featured-boxes-style-5 .featured-box .box-content h4, .featured-boxes-style-6 .featured-box .box-content h4, .featured-boxes-style-7 .featured-box .box-content h4 {
            color: #2e353e;
        }

    .featured-boxes-style-5 .featured-box .icon-featured, .featured-boxes-style-6 .featured-box .icon-featured, .featured-boxes-style-7 .featured-box .icon-featured {
        display: inline-block;
        font-size: 30px;
        height: 75px;
        padding: 0;
        width: 75px;
        margin-top: 0;
        margin-bottom: 10px;
        background: #FFF;
        border: 1px solid #dfdfdf;
        color: #777;
        line-height: 73px;
    }

    /* Featured Boxes - Style 6 */
    .featured-boxes-style-6 .featured-box .icon-featured {
        border: 1px solid #cecece;
        color: #777;
    }

        .featured-boxes-style-6 .featured-box .icon-featured:after {
            border: 5px solid #f4f4f4;
            border-radius: 50%;
            box-sizing: content-box;
            content: "";
            display: block;
            height: 100%;
            left: -6px;
            padding: 1px;
            position: absolute;
            top: -6px;
            width: 100%;
        }

    /* Featured Boxes - Style 7 */
    .featured-boxes-style-7 .featured-box .icon-featured {
        border: 1px solid #dfdfdf;
        color: #777;
    }

/* Featured Boxes - Style 8 */
.featured-boxes-style-8 .featured-box .icon-featured {
    display: inline-block;
    font-size: 30px;
    height: 75px;
    padding: 0;
    width: 75px;
    margin: -15px -15px 0 0;
    background: #FFF;
    line-height: 73px;
    border: 0;
    color: #777;
}

    .featured-boxes-style-8 .featured-box .icon-featured:after {
        display: none;
    }

/* Featured Boxes */
.featured-boxes .featured-box {
    margin-bottom: 0;
    margin-top: 0;
}

/* Effects */
.featured-box-effect-1 .icon-featured:after {
    top: -7px;
    left: -7px;
    padding: 7px;
    box-shadow: 0 0 0 3px #FFF;
    -webkit-transition: -webkit-transform 0.2s, opacity 0.2s;
    -webkit-transform: scale(1);
    -moz-transition: -moz-transform 0.2s, opacity 0.2s;
    -moz-transform: scale(1);
    -ms-transform: scale(1);
    transition: transform 0.2s, opacity 0.2s;
    transform: scale(1);
    opacity: 0;
}


.featured-box-effect-1.visible .icon-featured:after,
.featured-box-effect-1:hover .icon-featured:after {
    -webkit-transform: scale(0.8);
    -moz-transform: scale(0.8);
    -ms-transform: scale(0.8);
    transform: scale(0.8);
    opacity: 1;
}

.featured-box-effect-2 .icon-featured:after {
    top: -7px;
    left: -7px;
    padding: 7px;
    box-shadow: 0 0 0 3px #FFF;
    -webkit-transition: -webkit-transform 0.2s, opacity 0.2s;
    -webkit-transform: scale(0.8);
    -moz-transition: -moz-transform 0.2s, opacity 0.2s;
    -moz-transform: scale(0.8);
    -ms-transform: scale(0.8);
    transition: transform 0.2s, opacity 0.2s;
    transform: scale(0.8);
    opacity: 0;
}

.featured-box-effect-2:hover .icon-featured:after {
    -webkit-transform: scale(0.95);
    -moz-transform: scale(0.95);
    -ms-transform: scale(0.95);
    transform: scale(0.95);
    opacity: 1;
}

.featured-box-effect-3 .icon-featured:after {
    top: 0;
    left: 0;
    box-shadow: 0 0 0 10px #FFF;
    -webkit-transition: -webkit-transform 0.2s, opacity 0.2s;
    -webkit-transform: scale(0.9);
    -moz-transition: -moz-transform 0.2s, opacity 0.2s;
    -moz-transform: scale(0.9);
    -ms-transform: scale(0.9);
    transition: transform 0.2s, opacity 0.2s;
    transform: scale(0.9);
    opacity: 0;
}

.featured-box-effect-3:hover .icon-featured {
    color: #FFF !important;
}

    .featured-box-effect-3:hover .icon-featured:after {
        -webkit-transform: scale(1);
        -moz-transform: scale(1);
        -ms-transform: scale(1);
        transform: scale(1);
        opacity: 0.8;
    }

.featured-box-effect-4 .icon-featured {
    -webkit-transition: -webkit-transform 0.2s, transform 0.2s;
    -moz-transition: -moz-transform 0.2s, transform 0.2s;
    transition: transform 0.2s, transform 0.2s;
    -webkit-transform: scale(1);
    -moz-transform: scale(1);
    -ms-transform: scale(1);
    transform: scale(1);
}

.featured-box-effect-4:hover .icon-featured {
    -webkit-transform: scale(1.15);
    -moz-transform: scale(1.15);
    -ms-transform: scale(1.15);
    transform: scale(1.15);
}

.featured-box-effect-5 .icon-featured {
    overflow: hidden;
    -webkit-transition: all 0.3s;
    -moz-transition: all 0.3s;
    transition: all 0.3s;
}

.featured-box-effect-5:hover .icon-featured {
    -webkit-animation: toRightFromLeft 0.3s forwards;
    -moz-animation: toRightFromLeft 0.3s forwards;
    animation: toRightFromLeft 0.3s forwards;
}

@-webkit-keyframes toRightFromLeft {
    49% {
        -webkit-transform: translate(100%);
    }

    50% {
        opacity: 0;
        -webkit-transform: translate(-100%);
    }

    51% {
        opacity: 1;
    }
}

@-moz-keyframes toRightFromLeft {
    49% {
        -moz-transform: translate(100%);
    }

    50% {
        opacity: 0;
        -moz-transform: translate(-100%);
    }

    51% {
        opacity: 1;
    }
}

@keyframes toRightFromLeft {
    49% {
        transform: translate(100%);
    }

    50% {
        opacity: 0;
        transform: translate(-100%);
    }

    51% {
        opacity: 1;
    }
}

.featured-box-effect-6 .icon-featured:after {
    -webkit-transition: all 0.2s, -webkit-transform 0.2s;
    -moz-transition: all 0.2s, -moz-transform 0.2s;
    transition: all 0.2s, transform 0.2s;
}

.featured-box-effect-6:hover .box-content .icon-featured:after {
    -webkit-transform: scale(1.1);
    -moz-transform: scale(1.1);
    -ms-transform: scale(1.1);
    transform: scale(1.1);
}

.featured-box-effect-7 .icon-featured:after {
    opacity: 0;
    box-shadow: 3px 3px #d5d5d5;
    -webkit-transform: rotate(-90deg);
    -moz-transform: rotate(-90deg);
    -ms-transform: rotate(-90deg);
    transform: rotate(-90deg);
    -webkit-transition: opacity 0.2s, -webkit-transform 0.2s;
    -moz-transition: opacity 0.2s, -moz-transform 0.2s;
    transition: opacity 0.2s, transform 0.2s;
    left: 0;
    top: -1px;
}

.featured-box-effect-7:hover .icon-featured:after {
    opacity: 1;
    -webkit-transform: rotate(0deg);
    -moz-transform: rotate(0deg);
    -ms-transform: rotate(0deg);
    transform: rotate(0deg);
}

.featured-box-effect-7 .icon-featured:before {
    -webkit-transform: scale(0.8);
    -moz-transform: scale(0.8);
    -ms-transform: scale(0.8);
    transform: scale(0.8);
    opacity: 0.7;
    -webkit-transition: -webkit-transform 0.2s, opacity 0.2s;
    -moz-transition: -moz-transform 0.2s, opacity 0.2s;
    transition: transform 0.2s, opacity 0.2s;
}

.featured-box-effect-7:hover .icon-featured:before {
    -webkit-transform: scale(1);
    -moz-transform: scale(1);
    -ms-transform: scale(1);
    transform: scale(1);
    opacity: 1;
}


/* Counters */
.counters .counter {
    text-align: center;
}

.counters .fa, .counters .icons {
    display: block;
    font-size: 35px;
    line-height: 35px;
    margin-bottom: 5px;
}

.counters strong {
    display: block;
    font-weight: bold;
    font-size: 50px;
    line-height: 50px;
}

.counters label {
    display: block;
    font-weight: 100;
    font-size: 20px;
    line-height: 20px;
}

.counters .counter-side-icon .fa, .counters .counter-side-icon .icons, .counters .counter-side-icon strong {
    display: inline-block;
}

.counters .counter-with-unit strong {
    display: inline-block;
}

.counters.with-borders .counter {
    border-radius: 6px;
    border-top: 1px solid #DFDFDF;
    border-bottom: 1px solid #DFDFDF;
    border-left: 1px solid #ECECEC;
    border-right: 1px solid #ECECEC;
    box-shadow: 0 1px 1px 0 rgba(0, 0, 0, 0.04);
    padding: 25px;
}

.counters.counters-sm .fa, .counters.counters-sm .icons {
    font-size: 25px;
    line-height: 25px;
}

.counters.counters-sm strong {
    font-size: 35px;
    line-height: 35px;
}

.counters.counters-sm label {
    font-size: 15px;
    line-height: 15px;
}

.counters.counters-lg .fa {
    font-size: 45px;
    line-height: 45px;
}

.counters.counters-lg strong {
    font-size: 60px;
    line-height: 60px;
}

.counters.counters-lg label {
    font-size: 25px;
    line-height: 25px;
}

.counters.counters-text-light .counter {
    color: #FFF !important;
}

    .counters.counters-text-light .counter .fa, .counters.counters-text-light .counter .icons, .counters.counters-text-light .counter strong, .counters.counters-text-light .counter label {
        color: #FFF !important;
    }

.counters.counters-text-dark .counter {
    color: #2e353e !important;
}

    .counters.counters-text-dark .counter .fa, .counters.counters-text-dark .counter .icons, .counters.counters-text-dark .counter strong, .counters.counters-text-dark .counter label {
        color: #2e353e !important;
    }

        .avoid-clicks {
            pointer-events: none;
        }

ul.pager > li.previous.disabled {
    display: none;
}


.wizard-tabs ul > li.only-child > a:before,
.wizard-tabs ul > li.only-child > a:after,
.wizard-tabs ul > li.active.only-child > a:before,
.wizard-tabs ul > li.active.only-child > a:after {
    display: block;
    content: none;
    position: absolute;
    top: 0;
    right: -10px;
    z-index: 1;
    border: 17px solid transparent;
    border-right: 0;
    border-left: 10px solid transparent;
    width: 0;
    height: 0;
}

.panel-heading-layout {
    border-radius: 5px 5px 0 0;
    border-bottom: 1px solid #DADADA;
    position: relative;
    padding-left: 3%;
}

.panel-heading-Preview {
    position: relative;
    margin-top: 3px;
    margin-bottom: 3px;
}

.radio-layout {
    position: absolute;
    right: 3%;
    top: 0;
}

.img-layout {
    position: relative;
}

.verticallyStackedStory {
    position: absolute;
    left: 43%;
    top: 10px;
    color: #ffffff;
    font-weight: bold;
}


.verticallyStackedQuestion {
    position: absolute;
    left: 43%;
    top: 30px;
    color: #ffffff;
    font-weight: bold;
}

.verticallyStackedAnswer {
    position: absolute;
    left: 43%;
    top: 55px;
    color: #ffffff;
    font-weight: bold;
}

.verticalCenterWidget {
    vertical-align: bottom !important;
}

.storyLeftStory {
    position: absolute;
    left: 40%;
    top: 40%;
    color: #ffffff;
    font-weight: bold;
}

.storyLeftQuestion {
    position: absolute;
    left: 51%;
    top: 10%;
    color: #ffffff;
    font-weight: bold;
    font-size: 11px;
}

.storyLeftAnswer {
    position: absolute;
    left: 51%;
    top: 40%;
    color: #ffffff;
    font-weight: bold;
    font-size: 11px;
}

.storyRightStory {
    position: absolute;
    left: 105px;
    top: 70px;
    color: #ffffff;
    font-weight: bold;
}

.storyRightQuestion {
    position: absolute;
    left: 40px;
    top: 47px;
    color: #ffffff;
    font-weight: bold;
    font-size: 11px;
}

.storyRightAnswer {
    position: absolute;
    left: 39px;
    top: 87px;
    color: #ffffff;
    font-weight: bold;
    font-size: 11px;
}

.rowborders {
    margin-left: 10px !important;
    margin-right: 10px !important;
    position: relative;
    min-height: 75px;
}

.l-story {
    min-height: 70px;
    position: relative;
    width: 50%;
}

.answerposition-l {
    min-height: 40px;
    position: absolute;
    top: 37%;
    width: 50%;
    right: -3%;
}

.questionPosition-l {
    position: absolute;
    top: 0;
    width: 50%;
    right: -3%;
}

.r-story {
    min-height: 70px;
    position: absolute;
    width: 53%;
    right: -3%;
}

.answerposition-r {
    min-height: 40px;
    position: absolute;
    top: 37%;
    width: 50%;
    left: -3%;
}

.questionPosition-r {
    position: absolute;
    top: 0;
    width: 50%;
    left: -3%;
}

.widget-summary .summary .info-to-class {
    font-size: 1.4rem;
    line-height: 3rem;
    min-height: 50px;
}

.float-rigth {
    float: right;
}

/*---------End Elements Forms*/
/*------------------------------------------------------------------------------------------------------------------------------------------------------------------------------*/
/*------------------------------------------------------------------------------------------------------------------------------------------------------------------------------*/
/* Add here all your CSS customizations */

/*-----Objectives ---------*/

.tm-body.objectives {
    padding: 0;
}

.tm-body.objectives input[type='text'] {
        width: 85% !important;
        padding: 5px !important;
        /*display: none;*/
        margin-bottom: 0 !important;
    }

.timeline.timeline-simple .tm-body.objectives .tm-items > li:before {
    content: counters(item,".") !important;
    counter-increment: item;
    background: transparent;
    box-shadow: none;
}

.timeline.timeline-simple .tm-body.objectives .tm-items .first-level:before {
    top: 30px;
    margin-left: -16px;
}

.timeline.timeline-simple .tm-body.objectives .tm-items .second-level:before {
    top: 23px;
    margin-left: -26px;
}

.timeline.timeline-simple .tm-body.objectives .tm-items .three-level:before {
    top: 23px;
    margin-left: -34px;
}

/*Miguel cuarto nivel*/
.timeline.timeline-simple .tm-body.objectives .tm-items .forth-level:before {
    top: 12px;
    margin-left: -44px;
}

.timeline .tm-body.objectives:after {
    background: transparent;
}

.timeline .tm-body.objectives .tm-items > li {
    margin: 15px 0;
    padding: 0 0 0 35px;
}

.timeline .tm-body.objectives .tm-items {
    counter-reset: item;
}

.timeline .tm-body.objectives a {
    color: #fff;
    cursor: pointer;
}

.timeline .tm-body.objectives .first-level .tm-box {
    background-color: #4b6776;
    border-color: #415966;
    color: white;
}
.timeline.timeline-simple .tm-body.objectives .tm-items > li .tm-box:before {
    border-right-color: #415966;
    left: -16px;
    z-index: 3;
}

/*Background Second Level*/
.timeline .tm-body.objectives .second-level .tm-box {
    background-color: #5f8295;
    border-color: #557485;
    min-height: 45px !important;
    color: white;
}

.timeline .tm-body.objectives .second-level .tm-box:before {
    border-right-color: #5f8295 !important;
}

/*Background Third Level*/
.timeline .tm-body.objectives .three-level .tm-box {
    background-color: #7c9bab;
    border-color: #6c8fa1;
    color: white;
    min-height: 40px !important;
    padding: 5px 15px;
}

.timeline .tm-body.objectives .three-level .tm-box:before {
    border-right-color: #7c9bab !important;
}

/*Background Forth Level*/
.timeline .tm-body.objectives .forth-level .tm-box {
    background-color: #AEC3CF;
    border-color: #AEC3CF;
    color: white;
    min-height: 40px !important;
    padding: 5px 15px;
}

.timeline .tm-body.objectives .forth-level .tm-box:before {
        border-right-color: #7c9bab !important;
}


.timeline .tm-body.objectives .tm-box.has-error
{
    background-color: #a94442;
    border-color: #a94442;
}

.timeline .tm-body.objectives .second-level,
.timeline .tm-body.objectives .forth-level,
.timeline .tm-body.objectives .three-level {
    margin: 5px 0 0 0 !important;
    min-height: 20px !important;
}

.timeline .tm-body.objectives .second-level {
    min-height: 45px !important;
}

.timeline .tm-body.objectives .tm-box.selected {
    color: #3c763d;
    background-color: #dff0d8;
    border-color: #d6e9c6;
}

/* ------- Panels------*/
.panel .panel-buttons {
    right: 15px;
    position: absolute;
    top: 10px;
}

    .panel .panel-buttons.rigth {
        float: right;
    }

.note-frame.panel {
    margin-bottom: 0;
}

/*.btn.btn-success.fileinput-button {
    top: -10px;
    right: 10px;
}*/

.fileupload-container {
    bottom: 0;
    position: absolute;
    right: 0;
    margin-right: 20px;
    margin-bottom: 10px !important;
}

/*-----------CheckBox fixed -------------------*/

.checkbox-custom input[type="checkbox"]:checked + input[type="hidden"] + label:after {
    position: absolute;
    display: inline-block;
    font-family: 'Font Awesome 5 Pro';
    content: '\F00C';
    top: 50%;
    left: 4px;
    margin-top: -5px;
    font-size: 11px;
    line-height: 1;
    width: 16px;
    height: 16px;
    color: #333;
}

html.dark .checkbox-primary input[type="checkbox"]:checked + input[type="hidden"] + label:after,
.checkbox-primary input[type="checkbox"]:checked + input[type="hidden"] + label:after {
    color: #fff;
}



/*---------------Register -----------------*/
.body-sign.register {
    max-width: 600px;
}

.form-control-static {
    min-height: inherit;
    color: #000;
    padding-bottom: 0;
}

/*------------Header boxed---------------*/
header .header-container {
    margin: 0 auto;
    max-width: 1200px;
}

html.boxed .inner-wrapper {
    box-shadow: none;
}


@media only screen and (min-width: 1200px) {
    html.boxed .body {
        padding-top: 0;
    }
}

.header .logo {
    margin: 0 0 0 25px;
}

.header .logo,
.account.logo {    
    vertical-align: middle;
    margin-top: -2px;
}

    .header .logo img,
    .account.logo img{
        max-height: 46px;
        width: auto;
    }

    /*html.sidebar-light:not(.dark) .page-header {
    margin: -20px -20px 20px -25px;
    border-left: none;
    background: transparent;
}*/
    @media (max-width: 767px) {
        html .no-overflowscrolling .nano {
        height: 100% !important;
    }
}



.sidebar-left .nav.nav-main li form {
    padding: 10px 15px;
}

    .sidebar-left .nav.nav-main li form .form-control {
        font-size: inherit;
    }

.sidebar-left .nav-main > li > form .btn {
    width: 40px;
}


@media only screen and (min-width: 768px) {

    html.sidebar-left-collapsed .sidebar-left .nav-main > li > form {
        overflow: hidden;
    }

        html.sidebar-left-collapsed .sidebar-left .nav-main > li > form .form-control {
            display: none;
        }



    html.sidebar-left-collapsed .sidebar-left .nano:hover .nav-main li form .form-control {
        display: block;
    }

    html.header-fixed .inner-wrapper {
        margin-top: 0;
    }
}


/*----------Fixed awards certiticate--------*/

.panel-horizontal.panel-image .panel-heading, .panel-horizontal.panel-image .panel-body, .panel-horizontal.panel-image .panel-footer {
    display: block;
}


.inner-body.awards {
    min-height: 1% !important;
}

    .inner-body.awards .mg-files {
        padding: 5px 0 0 0 !important;
    }

.tab-content.tab-content-nopadding {
    padding: 15px 0;
}

.contentNone:after {
    content: none !important;
}

.contentNone:before {
    border-left-color: transparent !important;
}

.image-award {
    display: block;
    margin: auto;
    object-fit: scale-down;
    width: 100px;
}


/*------------Login fixed-------------- */

.body-sign.principal {
    max-width: 400px;
}

    .body-sign.principal.external {
        max-width: 500px !important;
    }

    .body-sign.principal .tab-content {
        box-shadow: none !important;
    }

html.sidebar-light:not(.dark) .sidebar-left .sidebar-header .sidebar-toggle {
    background: #fff;
}

.body-sign ul.nav li {
    display: inline-block;
    float: none;
}

    .body-sign ul.nav li.active a h2 {
        color: #fff !important;
        background-color: #269abc !important;
    }

    .body-sign ul.nav li a {
        padding: 0;
    }

.inline-buttons .input-group label.error,
.body-sign .input-group label.error,
.body-question .input-group label.error {
    position: absolute;
    top: 0;
    right: 0;
    bottom: 0;
    padding-right: 42px;
    font-size: 12px;
    line-height: 30px;
    z-index: 3;
    color: #979898;
    color: rgba(151,152,152,.8);
}

div.validation-message ul {
    margin: 20px -20px -20px -20px;
}

div.feedback-validation-panel ul {
    display: block;
}

.has-error .input-group-btn {
    vertical-align: top;
}

.has-error table.validate, .has-error .panel.panel-image {
    border: 1px solid #a94442 !important;
    -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075);
    box-shadow: inset 0 1px 1px rgba(0,0,0,.075);
}




/*------------Companies----------*/

.body-sign.body-locked {
    padding: 0;
    background: transparent !important;
}

    .body-sign.body-locked .logo {
        margin: 0 auto;
        display: block;
    }

/*.body-sign.body-locked*/
.background-color-light {
    background-color: #ffffff !important;
}


/*-------------Candidate panels------------------*/

.page-header.page-header-left-breadcrumb {
    padding-left: 0;
}





.panel.tests:hover .panel-heading {
    border-radius: 2px 2px 0 0;
}

.panel.tests h4:hover {
    text-decoration: none;
    text-underline: none;
}

/*.panel.tests .truncate {
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: normal;
    -webkit-line-clamp: 2;
    -webkit-box-orient: vertical;
    display: -webkit-box !important;
   height: 30px;
    font-size: 13px;
    font-weight: 600;
}*/

/*--------------boxuser----------------- */
.userbox .profile-info {
    min-width: 70px;
}

/*--------------Summary Tests-----------*/

.icon-stack {
    position: relative;
    display: inline-block;
    width: 2em;
    line-height: 4em;
    vertical-align: 23%;
}

.icon-stack-1x,
.icon-stack-2x,
.icon-stack-3x {
    position: absolute;
    left: 0;
    width: 100%;
    text-align: right;
}

.icon-stack-1x {
    width: 10px;
    left: 25px;
    top: 13px;
    font-size: .8em;
    background-color: #ecedf0;
}

.icon-stack-2x {
    font-size: 1.0em;
}

.icon-stack-3x {
    font-size: 1.3em;
}




@media only screen and (max-width: 767px) {
    .hidden-xs-inline {
        display: none;
    }
}


@media only screen and (min-width: 600px) {
    #preview-textfield {
        font-size: 6.5vh;
    }
}


@media only screen and (min-width: 768px) {
    #preview-textfield {
        font-size: 6vh;
    }
}

@media only screen and (min-width: 992px) {
    .vcenter {
        margin-top: 0%;
    }
}

@media only screen and (min-width: 1200px) {
    #preview-textfield {
        font-size: 7vh;
    }

    .vcenter {
        margin-top: 4.5%;
    }
}

.bar-summary {
    margin: 20px 0;
    border: 1px solid #e1e1e1;
    background-color: #ecedf0;
    border-radius: 5px;
}

    .bar-summary .col-lg-2,
    .bar-summary .col-lg-3,
    .bar-summary .col-lg-5,
    .bar-summary .col-lg-1 {
        text-align: center;
        padding-top: 20px;
        padding-bottom: 21px;
    }

@media (min-width: 992px) {


    .bar-summary .col-lg-1,
    .bar-summary .col-lg-2, .bar-summary .col-lg-3 {
        border-left: 1px solid #e1e1e1;
    }

        .bar-summary .col-lg-2:first-child, .bar-summary .col-lg-3:first-child, .bar-summary .col-lg-5:first-child,
        .bar-summary .col-md-4:nth-child(4) {
            border-left: none;
        }
}

.bar-summary .bar-icon {
    font-size: 28px;
    color: #000;
    display: inline-block;
    vertical-align: middle;
}

@media (max-width: 991px) {
    .bar-summary .bar-icon {
        min-width: 28px;
        text-align: center;
    }
}

.bar-summary .bar-textarea {
    display: inline-block;
    vertical-align: middle;
    text-align: left;
    margin-left: 7px;
}

.bar-summary h3 {
    color: #313131;
    font-size: 16px;
    font-weight: 600;
    margin: 0;
    line-height: 1.5;
}

.bar-summary p {
    font-size: 12px;
    margin: 0;
    line-height: 1;
}



.widget-summary .summary {
    min-height: 100px;
}

.summary .details-totals {
    width: 100%;
}

    .summary .details-totals th, .summary .details-totals td {
        border-top: 1px solid #DCDCDC;
        padding: 8px 10px;
    }

    .summary .details-totals tr.total .amount {
        font-size: 2em;
        display: block;
        padding-top: 10px;
    }




.panel.summary .widget-summary .widget-summary-col.widget-summary-col-icon {
    width: 30%;
}

.panel.summary .table > tbody > tr > td {
    padding: 0 4px;
}

.panel.summary table,
.panel.summary .panel {
    margin-bottom: 0;
}

.panel.summary .panel-body.no-radius-left {
    border-bottom-left-radius: 0;
    border-top-left-radius: 0;
}

.panel.summary .icon-featured {
    width: 250px;
    height: 250px;
    font-size: 130px;
    margin: 0 auto;
}

.panel.summary .featured-box-primary,
.panel.summary .featured-box-primary .icon-featured {
    background: transparent;
    border: none;
    line-height: 250px;
    box-shadow: none;
}

.panel.summary .featured-boxes .featured-box {
    margin-bottom: 0;
}


.panel.summary .counters .counter {
    line-height: 300px;
}

    .panel.summary .counters .counter strong {
        font-size: 95px;
        line-height: 95px;
    }

.panel.summary .counter-content {
    display: inline-block;
    vertical-align: middle;
}

.tab-content.transparent {
    background-color: transparent;
    padding: 0;
    border: none;
}

    .tab-content.transparent .label {
        padding: .3em .6em;
    }

.popover {
    max-width: 335px;
}


    .popover .social-icons-list a {
        background-color: #000;
    }

/*------Validation Errors*/
.has-error .ms-selection ul {
    border-color: #a94442;
    -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075);
    box-shadow: inset 0 1px 1px rgba(0,0,0,.075);
}

.has-error .form-control.search {
    border: 1px solid #ccc;
    -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075);
    box-shadow: inset 0 1px 1px rgba(0,0,0,.075);
}

.ms-container + label.error {
    float: right;
}


/*----------Fileupload-------------*/
/*html.sidebar-light:not(.dark) .inner-toolbar.transparent {
    background: transparent;
    border: none;
}

    html.sidebar-light:not(.dark) .inner-toolbar.transparent > ul li {
        border-right: none;
    }

.media-gallery .widget-summary .summary-footer {
    border-top: none;
}


.thumb-image .helper {
    padding-top: 100%;
}*/

/*.media-gallery .mg-files .thumbnail .thumb-preview .thumb-image {
    position: relative;
    width: 100%;
    min-height: 155px;
}

.media-gallery .mg-files .thumbnail .thumb-preview img {
    margin: auto;
    position: absolute;
    top: 0;
    bottom: 0;
    left: 0;
    right: 0;
    display: flex;
    justify-content: center;
    align-items: center;
}*/

/*---------Panels---------*/
/*.panel:not(.panel-featured):not(.panel-featured-top):not(.panel-featured-left) {
    border: 1px solid #cecece;
}



.panel.panel-noborder {
    border: none !important;
}*/




.b-gray {
    border: 1px solid #cecece;
}

.panel.border-body {
    border-left: none;
    border-right: none;
    border-bottom: none;
    box-shadow: none;
}

    .panel.border-body .panel-body {
        border: 1px solid #dddddd;
        border-top-left-radius: 0;
        border-top-right-radius: 0;
        border-top: none;
    }

.min-width-100 {
    min-width: 100px;
}

.min-width-200 {
    min-width: 200px;
}


/*----------Wizard---------*/
.wizard-tabs ul > li.active {
    border-bottom-color: #EEE;
}


/*---Extensions Elements Skins--*/



/*--------Reset password*/
.body-sign.recovery-password,
.body-sign.reset-password {
    max-width: 600px;
}
.body-sign.reset-password .panel-body,
.body-sign.recovery-password .panel-body {
    padding: 15px 33px;
}

.body-sign.reset-password .alert,
.body-sign.recovery-password .alert {
    padding: 0;
}

.body-sign.reset-password .alert {
    margin-bottom: 5px;
}

.body-sign .panel-sign .panel-title-sign .title.success {
    background-color: #47a447;
    border-color: #47a447;
}

.body-sign .panel-sign .panel-body.success {
    border-top-color: #47a447;
}

/*------------Date picker---------*/
.datepicker-dropdown {
    z-index: 2000;
}


/*---------Reorder dataTables*/

/*table.table thead .sorting_asc,
table.table thead .sorting_desc,
table.table thead .sorting {
    background-position: center left !important;
}

.dataTables_wrapper table thead th {
    padding-right: 0 !important;    
}


.dataTables_wrapper table thead th.sorting_asc,
.dataTables_wrapper table thead th.sorting_desc,
.dataTables_wrapper table thead th.sorting {
    
    padding-left: 21px !important;
}*/


table.dt-rowReorder-float {
    position: absolute !important;
    opacity: 0.8;
    table-layout: fixed;
    outline: 2px solid #888 !important;
    outline-offset: -2px;
    z-index: 2001;
}

tr.dt-rowReorder-moving {
    outline: 2px solid #555;
    outline-offset: -2px;
}

body.dt-rowReorder-noOverflow {
    overflow-x: hidden;
}

table.dataTable td.reorder {
    text-align: center;
    cursor: move;
}

@media (min-width: 768px) {
    .datatables-header.form-inline .input-group {
        width: 100%;
    }

    .datatables-header.form-inline .input-group-btn {
        width: 1%;
    }
}

/*----------Paginatio-----------*/
.datatables-header .view-mode {
    float: right;
    margin-right: 10px;
    line-height: 29px;
    height: 30px;
    margin-top: 3px;
}

    .datatables-header .view-mode i {
        font-size: 14px;
        border: 1px solid #ccc;
        background-color: #fff;
        color: #ccc;
        width: 26px;
        height: 26px;
        line-height: 24px;
        display: inline-block;
        text-align: center;
        border-radius: 3px;
        vertical-align: top;
    }

    .datatables-header .view-mode a.active i, .toolbar .view-mode a.active:focus i {
        color: #fff;
        background-color: #0088CC;
        border-color: #0088CC;
    }

    .datatables-header .view-mode a:hover i, .toolbar .view-mode a:focus i {
        color: #fff;
        background-color: #0088CC;
        border-color: #0088CC;
        cursor: pointer;
    }



/*------Gellery media elements*/

.masonry .masonry-item {
    border-right: 2.5px solid #333 !important;
    border-left: 2.5px solid #333 !important;
}

    .masonry .masonry-item[style*="left: 0px"] {
        border-left: 5px solid #333 !important;
    }

    .masonry .masonry-item:nth-child(5n+0) {
        border-right: 5px solid #333 !important;
    }


    .masonry .masonry-item[style*="top: 0px"] {
        border-top: 5px solid #333 !important;
        border-bottom: 2.5px solid #333 !important;
    }

    .masonry .masonry-item:nth-child(even) {
        border-top: 5px solid #333 !important;
        border-bottom: 5px solid #333 !important;
    }


.media-gallery .fileinput-button {
    top: 0 !important;
}



/*-------NESTABLE--------------*/

.dd3-content {
    display: block;
    /* height: 34px; */
    margin: 5px 0;
    padding: 5px 10px 5px 40px;
    background: #fafafa;
    background: -webkit-linear-gradient(top, #fafafa 0%, #eee 100%);
    background: -moz-linear-gradient(top, #fafafa 0%, #eee 100%);
    background: linear-gradient(top, #fafafa 0%, #eee 100%);
    -webkit-border-radius: 3px;
    border-radius: 3px;
    box-sizing: border-box;
    -moz-box-sizing: border-box;
    border: 1px solid #ccc;
}

    .dd3-content input[type=text] {
        -ms-border-top-left-radius: 0 !important;
        border-top-left-radius: 0 !important;
        -ms-border-bottom-left-radius: 0 !important;
        border-bottom-left-radius: 0 !important;
    }

    .dd3-content:hover {
        color: #2ea8e5;
        background: #fff;
    }


.dd-dragel {
    position: absolute;
    pointer-events: none;
    z-index: 20002;
}

    .dd-dragel > .dd-item .dd-handle {
        margin-top: 0;
    }

    .dd-dragel .dd-handle {
        -webkit-box-shadow: 2px 4px 6px 0 rgba(0,0,0,.1);
        box-shadow: 2px 4px 6px 0 rgba(0,0,0,.1);
    }

    .dd-dragel > .dd3-item > .dd3-content {
        margin: 0;
    }

.dd3-item > button {
    margin-left: 30px;
}

.dd3-handle {
    position: absolute;
    margin: 0;
    left: 0;
    /* top: 0; */
    cursor: pointer;
    width: 30px;
    /* text-indent: 100%; */
    white-space: nowrap;
    overflow: hidden;
    overflow: -moz-hidden-unscrollable;
    border: 1px solid #006699;
    background: #0088cc;
    background: -webkit-linear-gradient(top, #0088cc 0%, #006699 100%);
    background: -moz-linear-gradient(top, #0088cc 0%, #006699 100%);
    background: linear-gradient(top, #0088cc 0%, #006699 100%);
    -ms-border-top-right-radius: 0;
    border-top-right-radius: 0;
    vertical-align: middle;
    height: 100%;
    -ms-border-bottom-right-radius: 0;
    border-bottom-right-radius: 0;
}

    .dd3-handle:before {
        font-family: 'Font Awesome 5 Pro';
        content: '\f047';
        display: block;
        position: absolute;
        top: 50%;
        left: 50%;
        height: 30%;
        width: 50%;
        margin: -35% 0 0 -25%;
        color: #fff;
        font-size: 14px;
        font-weight: normal;
    }

    .dd3-handle:hover {
        background: #0099e6;
    }


/*-----Multiselect-----------*/
.ms-container .ms-selectable, .ms-container .ms-selection {
    width: 48%;
}

.none-border-radius {
    border-radius: 0 !important;
}

/*-------Left sidebar-------------*/
.sidebar-left .sidebar-header .sidebar-title, .sidebar-left .sidebar-toggle, html.sidebar-left-collapsed .sidebar-left .sidebar-toggle {
    border-top-left-radius: 5px !important;
    border-top-right-radius: 5px !important;
}




/*---------Register-------*/
.select2-sm .select2-container--bootstrap .select2-selection__rendered {
    font-size: 12px;
    line-height: 2;
}





.panel-group.panel-group-sm .panel-heading a {
    padding: 5px 15px;
    font-size: 0.9em;
}

.panel-group.panel-group-sm .panel-body {
    font-size: 0.9em;
}

.panel-group.panel-group-lg .panel-heading a {
    padding: 15px 15px;
    font-size: 1em;
    font-weight: 600;
}

.panel-group.without-bg .panel-default {
    background: transparent !important;
}

    .panel-group.without-bg .panel-default > .panel-heading {
        background: transparent !important;
    }

.panel-group.without-bg .panel-body {
    padding-top: 0;
    padding-bottom: 0;
}

.panel-group.without-borders .panel {
    border: 0;
    box-shadow: none;
    border-bottom: 1px solid #DDD;
    border-radius: 0;
}

.panel-group.without-borders .panel-heading a {
    padding-left: 0;
    padding-right: 0;
}

.panel-group.without-borders .panel-body {
    padding: 0;
}


/*.widget-profile-info .profile-info .profile-footer.gray {
    border-top-color: #cecece;
}


.widget-profile-info {
    margin: 0 auto;
    width: 90px;
    height: 90px;
    line-height: 90px;
    text-align: center;
}



    .widget-profile-info .profile-picture img {
        width: 300px;
        height: auto !important;
        margin-right: 0 !important;
    }

.panel-horizontal.panel-image {
    display: block;
}

@media (min-width: 992px) {
    .widget-profile-info .profile-picture img, .widget-profile-info {
        width: 100%;
    }
}

@media (min-width: 1200px) {
    .widget-profile-info .profile-picture img {
        width: 300px;
    }

    .widget-profile-info {
        width: 100px;
        height: 100px;
    }
}*/



.disabled-link {
    text-decoration: none;
    color: gray !important;
    pointer-events: none;
    cursor: default;
}

    .disabled-link i {
        color: gray !important;
    }

/*---------Courses------------*/


/*----------Play course-------*/

.course-taking .player-container {
        background: #ecedf0;
        position: absolute;
        top: 0;
        bottom: 0;
        height: auto !important;
        -webkit-transition: padding .4s ease;
        -moz-transition: padding .4s ease;
        -ms-transition: padding .4s ease;
        -o-transition: padding .4s ease;
        transition: padding .4s ease;
        padding-top: 110px;
}

.body-student.course-taking .breadcrumbs span {
    line-height: 1.4rem;
}


@media (max-width: 530px) {
    .body-student.course-taking .hiddentext {
        display: none !important;
    }
}



.jcrop-holder {
    margin: 0 auto !important;
}

.container-buttons-crop {
    display: table;
    margin: 0 auto;
    padding-top: 10px;
    min-width: 100px;
}


.pull-right.actions-content {
    position: absolute;
    right: 25px;
    padding-top: 15px;
    z-index: 1000 !important;
}

.tab-content .panel-footer.footer-courses {
    margin: 0;
    margin-top: -5px;
}

.tab-content.courses-tabcontent .row.datatables-footer {
    margin-left: 0 !important;
    margin-right: 0 !important;
}

    .tab-content.courses-tabcontent .row.datatables-footer ul.pagination {
        margin: 20px 0 0 0;
    }



.course-btn-group .search {
    -ms-border-top-right-radius: 0;
    border-top-right-radius: 0;
    -ms-border-bottom-right-radius: 0;
    border-bottom-right-radius: 0;
}


.course-btn-group .btn-group-custom {
    -webkit-border-radius: 0px !important;
    -moz-border-radius: 0px !important;
    border-radius: 0px !important;
}

    .course-btn-group .btn-group-custom.last-btn {
        -ms-border-top-right-radius: 4px !important;
        border-top-right-radius: 4px !important;
        -ms-border-bottom-right-radius: 4px !important;
        border-bottom-right-radius: 4px !important;
    }


        ul.accordion.lectures > li:last-child .comment-block {
            border-bottom: 0;
        }

    ul.accordion.lectures li .comments {
        margin-bottom: 10px;
    }



        ul.accordion.lectures .comment-block .pull-right.actions {
            -ms-opacity: 0;
            opacity: 0;
        }


        ul.accordion.lectures .comment-block:hover .pull-right.actions {
            -ms-opacity: 1;
            opacity: 1;
        }


        ul.accordion.lectures .comment-block .comment-by {
            display: block;
            font-size: 1em;
            line-height: 21px;
            margin: 0;
            padding: 0 0 5px 0;
        }

/*---------end lessions ----------------*/

.bg-transparent {
    background-color: transparent !important;
}

.bg-white {
    background-color: #fff !important;
}

#container-pptx .document-viewer-wrapper {
    margin: 0;
}

/*.panel.panel-course {
    border: none !important;
}*/

.panel-courses > .panel-body {
    padding: 0px;
}
    .panel-courses > .panel-body > img {
        width: 100%;
        height: 100%;
        border-radius: 3px 3px 0px 0px;
    }

    

    .panel-courses > .panel-footer {
        text-align: left;
        background-color: #fff;
    }

    .panel-courses > .panel-footer p {
        margin-bottom: 5px;
    }

        .panel-courses > .panel-footer > h4 {
            height: 5.07rem;
        }

        .panel-courses > .panel-footer > p.description {
            height: 3.5rem;
        }


    /*.panel.panel-course > .panel-body {
        border-top: none;
        border-left: 1px solid #ddd;
        border-right: 1px solid #ddd;
        border-top-left-radius: 6px;
        border-top-right-radius: 6px;
    }*/
    /*.panel.panel-course > .panel-body.content { 
            height: 326px;
        }*/
    /*.panel.panel-course > .panel-body.content .owl-carousel {
                height: 100px;
            }


            .panel.panel-course > .panel-body.content .course-content-description {
                height: 175px;
            }*/
    /*.panel.panel-course > .panel-body.content .course-description {
            height: 40px;
        }*/
    /*.panel.panel-course > .panel-footer {
        border: 1px solid #ddd;
        border-radius: 0;
    }*/
    /*.panel.panel-course .item.course {
        position: relative;
    }*/
    /*.panel.panel-course .item.course img {
            border-bottom-left-radius: 0;
            border-bottom-right-radius: 0;
        }*/
    .input-group-addon.with-borders {
        padding: 6px 12px;
        font-size: 14px;
        font-weight: 400;
        line-height: 1;
        text-align: center;
        background-color: transparent !important;
        border: none !important;
        color: #47a447;
    }


.post-image.logo.has-error
.post-image.course.has-error,
#award-icon.has-error {
    border: 1px solid #a94442;
    background-color: #e8a69f !important;
    color: #702010;
}

#award-icon .profile-picture img {
    border-radius: 0px;
}

.post-image {
    background-color: transparent;
    border: none;
    display: block;
    border-radius: 5px;
    color: #777;
}

    .post-image.course {
        min-height: 256px;
    }

.post-image.logo {
    min-height: 15px;
    margin-top: 10px;
    margin-bottom: 10px;
}

    .post-image.course:empty {
        background-color: #EEE;
        border: 1px dotted #cecece;
    }

    .post-image.logo .image-drip,
    .post-image.logo .image-status,
    .post-image.course .image-drip,
    .post-image.course .image-status {
        left: 0;
        top: 0;
        right: 0;
        bottom: 0;
    }

    
    .post-image.course .image-drip,
    .post-image.course .image-status {
        position: absolute;
    }

#award-icon .image-status {
    font-size: 13px;
}

.post-image.course .image-drip > span {
    position: absolute;
    left: 0;
    top: 0;
    opacity: 0;
    margin-left: -25%;
    margin-top: -25%;
    width: 50%;
    padding-bottom: 50%;
}

    .post-image.course .image-drip > span > span {
        position: absolute;
        width: 100%;
        height: 100%;
        background-color: rgba(0,0,0,.25);
        border-radius: 50%;
        opacity: .5;
        left: 0;
        top: 0;
    }

.post-image.course .image-status {
    padding: 3em 1.5em;
    display: -webkit-box;
    display: -ms-flexbox;
    display: flex;
    -webkit-box-align: center;
    -ms-flex-align: center;
    align-items: center;
    -webkit-box-pack: center;
    -ms-flex-pack: center;
    justify-content: center;
    text-align: center;
    -webkit-box-orient: vertical;
    -webkit-box-direction: normal;
    -ms-flex-direction: column;
    flex-direction: column;
    pointer-events: none;
}





body .btn-borders.btn-success:hover span {
    color: #FFF !important;
}



[ng\:cloak], [ng-cloak], [data-ng-cloak], [x-ng-cloak], .ng-cloak, .x-ng-cloak {
    display: none !important;
}



.header-border-bootom {
    border-bottom: 1px solid #cecece !important;
}

/* Vertical */
.tabs-vertical {
    display: table;
    width: 100%;
    padding: 0;
    border-top: 1px solid #EEE;
}

    .tabs-vertical .tab-content {
        display: table-cell;
        vertical-align: top;
    }


    .tabs-vertical .nav-tabs > li {
        display: block;
    }

        .tabs-vertical .nav-tabs > li a {
            border-radius: 0;
            display: block;
            padding-top: 10px;
        }

            .tabs-vertical .nav-tabs > li a, .tabs-vertical .nav-tabs > li a:hover, .tabs-vertical .nav-tabs > li a:focus {
                border-bottom: none;
                border-top: none;
            }

        .tabs-vertical .nav-tabs > li.active a,
        .tabs-vertical .nav-tabs > li.active a:hover, .tabs-vertical .nav-tabs > li.active:focus {
            border-top: none;
        }


/* Navigation */
.tabs-navigation {
    border-radius: 5px;
}

    .tabs-navigation .nav-tabs > li {
        margin-bottom: 1px;
    }

        .tabs-navigation .nav-tabs > li a {
            color: #777;
            padding: 18px;
            line-height: 100%;
        }

            .tabs-navigation .nav-tabs > li a:before {
                font-family: 'Font Awesome 5 Pro';
                content: "\f054";
                position: absolute;
                right: 15px;
                top: 50%;
                margin-top: -7px;
            }

            .tabs-navigation .nav-tabs > li a .fa, .tabs-navigation .nav-tabs > li a .icons {
                margin-right: 4px;
            }

        .tabs-navigation .nav-tabs > li:first-child a {
            border-radius: 5px 5px 0 0;
        }

        .tabs-navigation .nav-tabs > li.active a, .tabs-navigation .nav-tabs > li.active a:hover, .tabs-navigation .nav-tabs > li.active a:focus {
            border-right-color: #eee;
        }

        .tabs-navigation .nav-tabs > li:last-child a {
            border-radius: 0 0 5px 5px;
        }


.tab-pane-navigation {
    display: none;
}

    .tab-pane-navigation.active {
        display: block;
    }
/* Vertical - Left Side */
.tabs-left {
    padding: 0;
}

    .tabs-left .tab-content {
        border-radius: 0 5px 5px 5px;
        border-left: none;
    }

    .tabs-left .nav-tabs > li {
        margin-right: -1px;
    }

        .tabs-left .nav-tabs > li:first-child a {
            border-radius: 5px 0 0 0;
        }

        .tabs-left .nav-tabs > li:last-child a {
            border-radius: 0 0 0 5px;
            border-bottom: 1px solid #eee;
        }

        .tabs-left .nav-tabs > li a {
            border-right: 1px solid #EEE;
            border-left: 3px solid #EEE;
            margin-right: 1px;
            margin-left: -3px;
        }

            .tabs-left .nav-tabs > li a:hover {
                border-left-color: #CCC;
            }

        .tabs-left .nav-tabs > li.active a,
        .tabs-left .nav-tabs > li.active a:hover,
        .tabs-left .nav-tabs > li.active a:focus {
            border-left: 3px solid #CCC;
        }


#courseCurriculum .panel-group .panel-accordion .panel-heading {
    padding: 18px;
}

    #courseCurriculum .panel-group .panel-accordion .panel-heading a {
        padding: 0;
    }


div.tabs-course > ul {
    margin-top: -41px;
}

.tabs.tabs-course {
    /*margin-top: -41px;*/
    margin-bottom: 0;
}

/*.tabs.tabs-course > ul li {
        min-width: 200px;
    }*/

.panel-body.panel-body-courses,
.panel-body.panel-body-courses .panel-body.transparent {
    background-color: transparent;
}

    .panel-body.panel-body-courses .tab-content {
        border: none;
        box-shadow: none;
    }

body .btn.btn-hover {
    font-weight: normal;
    color: #999;
    cursor: pointer;
    background-color: inherit;
    border-color: transparent;
}

/*-----------animation--------------*/

.slide-animate.ng-enter, .slide-animate.ng-leave {
    transition: all cubic-bezier(0.250, 0.460, 0.450, 0.940) 0.5s;
    position: absolute;
    top: 0;
    left: 0;
    right: 0;
    bottom: 0;
    display: block;
}

.slide-animate.ng-enter {
    top: -50px;
}

    .slide-animate.ng-enter.ng-enter-active {
        top: 0;
    }

.slide-animate.ng-leave {
    top: 0;
}


    .slide-animate.ng-leave.ng-leave-active {
        top: 50px;
    }

.remove-content {
    opacity: 0;
    position: relative;
    bottom: -6px;
    right: 12px;
    z-index: 1;
    font-size: 6mm;
    cursor: pointer;
}

.panel-remove:hover i.remove-content {
    opacity: 1;
}

.counters.with-borders .counter {
    padding: 10px;
}

html .counters .counter-primary:hover {
    border-color: #47a447;
    cursor: pointer;
}

    html .counters .counter-primary:hover i {
        color: #47a447;
    }



.ui-sortable-placeholder {
    margin-bottom: 15px !important;
    padding: 0;
    border: 1px dashed #dddddd !important;
    background: #BAEAF8 !important;
    color: #444444;
    visibility: visible !important;
}

.simple-todo-list.content > li:not(:last-child) {
    border-bottom: 1px solid #DDD;
    padding-bottom: 8px;
}

.simple-todo-list.content > li .title {
    color: #A7A7A7;
    font-size: 1.1rem;
}

/*.course-html {
    width: 80%;
    margin: 0 auto;
}*/

    .course-html .img-content {
        margin: 0 auto;
        display: block;
    }

#container-pdf {
    overflow: hidden;
    margin: 0 auto;
}

    #container-pdf iframe {
        position: absolute;
        top: 0;
        left: 0;
        width: 100%;
        height: 100%;
    }

/* Navigation of courses content */
html.sidebar-left-collapsed .sidebar-left .nav-main a h2 {
    visibility: hidden;
}

html.sidebar-left-collapsed .sidebar-left .nav-main a.accordion-toggle {
    height: 40px;
}

html.sidebar-left-collapsed .sidebar-left .nano:hover .nav-main a.accordion-toggle {
    height: auto;
}

html.sidebar-left-collapsed .sidebar-left .nav-main .accordion-body.collapse.in {
    display: none;
}

html.sidebar-left-collapsed .sidebar-left .nano:hover .nav-main .accordion-body.collapse.in {
    display: block;
}

html.sidebar-left-collapsed .sidebar-left .nano:hover .nav-main div.panel a h2,
html.sidebar-left-collapsed .sidebar-left .nano:hover .nav-main div.panel a span {
    visibility: visible;
}


.panel-group .panel-heading.br-none,
.panel-group .panel-heading.br-none a {
    border-radius: 0;
}



/*----- sidebar help---------*/
.sidebar.shop-sidebar .panel-group {
    margin-bottom: 40px;
}

    .sidebar.shop-sidebar .panel-group .panel + .panel {
        margin-top: 14px;
    }

.sidebar.shop-sidebar .panel.panel-default {
    border-radius: 0;
    border: none;
}

    .sidebar.shop-sidebar .panel.panel-default .panel-heading {
        border-radius: 0;
    }

        .sidebar.shop-sidebar .panel.panel-default .panel-heading .panel-title {
            margin: 0;
            font-size: 13px;
            font-weight: 700;
            text-transform: uppercase;
            color: #777;
        }

        .sidebar.shop-sidebar .panel.panel-default .panel-heading a {
            display: block;
            padding: 10px 15px;
            position: relative;
            border-radius: 0 0 0 0;
            padding-top: 11.5px;
            padding-bottom: 11.5px;
            padding-right: 45px;
            color: #777;
            border: 1px solid #ddd;
        }

            .sidebar.shop-sidebar .panel.panel-default .panel-heading a:before {
                font-family: 'Font Awesome 5 Pro';
                content: "\f0d8";
                width: 26px;
                height: 26px;
                display: block;
                border: 1px solid #ddd;
                position: absolute;
                right: 15px;
                top: 50%;
                margin-top: -13px;
                border-radius: 0;
                color: #ccc;
                text-align: center;
                line-height: 24px;
                background-color: #fff;
                font-size: 10px;
            }

            .sidebar.shop-sidebar .panel.panel-default .panel-heading a:hover:before {
                background-color: #00aadc;
                border-color: #00aadc;
                color: #fff;
            }

            .sidebar.shop-sidebar .panel.panel-default .panel-heading a.collapsed {
                border-radius: 0;
            }

                .sidebar.shop-sidebar .panel.panel-default .panel-heading a.collapsed:before {
                    content: "\f0d7";
                }

    .sidebar.shop-sidebar .panel.panel-default .panel-body {
        padding: 15px 15px 7px;
        border: 1px solid #ddd;
        border-top: none;
        border-radius: 0 0 0 0;
        background-color: #fbfbfb;
    }

.sidebar.shop-sidebar .filter-price {
    margin: 14px 0 9px;
}

    .sidebar.shop-sidebar .filter-price #price-slider {
        margin-bottom: 20px;
    }

    .sidebar.shop-sidebar .filter-price .noUi-target {
        background: #eee;
        border-radius: 0;
        border: none;
        box-shadow: none;
    }

    .sidebar.shop-sidebar .filter-price .noUi-handle {
        background: #00aadc;
        cursor: pointer;
        border-radius: 0;
        border: none;
        box-shadow: none;
    }

        .sidebar.shop-sidebar .filter-price .noUi-handle:before, .sidebar.shop-sidebar .filter-price .noUi-handle:after {
            display: none;
        }

    .sidebar.shop-sidebar .filter-price .noUi-horizontal {
        position: relative;
        height: 7px;
    }

        .sidebar.shop-sidebar .filter-price .noUi-horizontal .noUi-handle {
            position: absolute;
            width: 13px;
            height: 18px;
            border: 0;
            left: -6.5px;
            top: -6px;
        }

        .sidebar.shop-sidebar .filter-price .noUi-horizontal .noUi-base .noUi-origin {
            position: absolute;
        }

    .sidebar.shop-sidebar .filter-price .noUi-connect {
        background-color: #0087be;
        box-shadow: inset 0 0 3px rgba(51, 51, 51, 0.45);
    }

    .sidebar.shop-sidebar .filter-price .filter-price-details {
        text-align: center;
    }

        .sidebar.shop-sidebar .filter-price .filter-price-details * {
            white-space: normal;
        }

        .sidebar.shop-sidebar .filter-price .filter-price-details span {
            vertical-align: middle;
            line-height: 26px;
        }

        .sidebar.shop-sidebar .filter-price .filter-price-details .form-control {
            display: inline-block;
            vertical-align: middle;
            color: #a3a2a2;
            padding: 2px 5px;
            font-size: 14px;
            margin: 0 2px;
            width: 50px;
            height: 26px;
        }

        .sidebar.shop-sidebar .filter-price .filter-price-details .btn {
            border: none;
            height: 26px;
            line-height: 26px;
            color: #fff;
            border-radius: 0;
            padding: 0 10px;
            font-size: 14px;
            margin: 5px 0;
        }

.sidebar.shop-sidebar ul, .sidebar.shop-sidebar ol {
    padding: 0;
    margin: -7px 0 0;
    list-style: none;
}

    .sidebar.shop-sidebar ul li a, .sidebar.shop-sidebar ol li a {
        color: #777;
        line-height: 2.5;
    }

.sidebar.shop-sidebar .configurable-filter-list {
    padding: 0;
    margin: 0 -5px;
    list-style: none;
    font-size: 0;
}

    .sidebar.shop-sidebar .configurable-filter-list li {
        display: inline-block;
        margin: 0 5px 8px;
    }

        .sidebar.shop-sidebar .configurable-filter-list li a {
            display: block;
            color: #777;
            width: 30px;
            height: 30px;
            font-size: 14px;
            line-height: 28px;
            background: #f4f4f4;
            border: 1px solid #cccccc;
            border-radius: 0;
            float: left;
            margin: 0;
            padding: 0;
            text-align: center;
        }

            .sidebar.shop-sidebar .configurable-filter-list li a:hover {
                border-color: #00aadc;
                text-decoration: none;
            }

    .sidebar.shop-sidebar .configurable-filter-list.filter-list-color li a {
        padding: 1px;
    }

        .sidebar.shop-sidebar .configurable-filter-list.filter-list-color li a span {
            display: inline-block;
            width: 26px;
            height: 26px;
            border-radius: 0;
        }

.sidebar.shop-sidebar h4 {
    margin-bottom: 10px;
    text-transform: uppercase;
}

.sidebar.shop-sidebar .owl-carousel .owl-nav {
    top: -28px;
    width: auto;
    right: 5px;
    margin: 0;
    line-height: 1;
}

    .sidebar.shop-sidebar .owl-carousel .owl-nav .owl-prev,
    .sidebar.shop-sidebar .owl-carousel .owl-nav .owl-next {
        font-size: 16px;
        line-height: 1;
        min-width: 18px;
    }

.widget-summary .summary-icon.image {
    width: 130px;
}


/*----------Toggle extension---- */
.toggle.toggle-simple .toggle {
    border-bottom: 1px solid #cecece;
    padding-bottom: 10px !important;
}


    .toggle.toggle-simple .toggle > label {
        border-radius: 0;
        border: 0;
        background: transparent;
        color: #777;
        padding-left: 32px;
        margin-bottom: -10px;
        font-size: 20px;
        font-weight: 600;
        color: #1d2127;
    }

        .toggle.toggle-simple .toggle > label:after {
            content: '';
            position: absolute;
            left: 0;
            display: block;
            width: 24px;
            height: 24px;
            background: #CCC;
            top: 23px;
            margin-top: -12px;
            border-radius: 3px;
            z-index: 1;
        }

        .toggle.toggle-simple .toggle > label:before {
            border: 0;
            left: 7px;
            right: auto;
            margin-top: 0;
            top: 12px;
            font-family: 'Font Awesome 5 Pro';
            content: "\f067";
            z-index: 2;
            color: #FFF;
            font-size: 13px;
        }

    .toggle.toggle-simple .toggle.active > label {
        background: transparent !important;
        color: #1d2127;
    }

        .toggle.toggle-simple .toggle.active > label:before {
            content: "\f068";
        }

.btn-portfolio-infinite-scroll {
    opacity: 0;
}

.outline-none {
    outline: 0 !important;
}



.course-details-content h3 {
    text-transform: uppercase;
    font-size: 28px;
    margin-bottom: 20px;
    padding: 5px 0 0 40px;
}

.course-details-content ul.post-info {
    border-bottom: 1px solid #edeaea;
    padding: 0 0 32px 40px;
    margin-bottom: 35px;
}

    .course-details-content ul.post-info li {
        display: inline-block;
        margin-right: 30px;
    }

/*.course-details-content .sub-text {
    padding-left: 40px;
}*/

ul.nav-main.courses li i {
    font-size: inherit;
}

.course-details-content .sub-text h4,
.course-curriculum h4 {
    font-family: 'Lato', sans-serif;
    text-transform: uppercase;
    margin-bottom: 20px;
}

.course-details-content .sub-text p {
    margin-bottom: 20px;
}

.course-details-content .sub-text ul.st-requirements-list {
    margin-bottom: 25px;
    list-style-type: none;
}

    .course-details-content .sub-text ul.st-requirements-list li {
        display: block;
        width: 50%;
        float: left;
        margin-bottom: 10px;
    }

        .course-details-content .sub-text ul.st-requirements-list li i {
            font-size: 16px;
            vertical-align: middle;
            margin-right: 15px;
        }

.course-details-content .clear-fix:after {
    display: table;
    content: '';
    clear: both;
}


.course-details-content .sub-text ul.event-output-list {
    margin-bottom: 40px;
    list-style-type: none;
}

    .course-details-content .sub-text ul.event-output-list li {
        display: block;
        margin-bottom: 10px;
    }

        .course-details-content .sub-text ul.event-output-list li i {
            font-size: 16px;
            color: #005A85;
            margin-right: 8px;
            vertical-align: middle;
        }




.course-curriculum.navigation {
    padding-right: 0px;
    margin-top: 0px;
    padding-left: 0px;
}


.course-curriculum .single-panel-area {
    background-color: #ECECEC;
    padding: 0px 15px;
    margin-bottom: 10px;
    border-radius: 3px;
    border: 0.1em solid #cecece;
}

    .course-curriculum .single-panel-area > a > h5 {
        padding: 5px 0;
    }

        .course-curriculum .single-panel-area > a > h5.title {
            display: block;
            position: relative;
            padding: 5px 40px 5px 0px;
        }

    .course-curriculum.navigation .single-panel-area {
        background-color: #FFF;
        padding: 1px 5px;
        border-radius: 0px;
        border: none;
        margin-bottom: 0px;
        border-bottom: 0.1em solid #cecece;
    }

.course-curriculum h6 {
    font-weight: 600;
    text-transform: uppercase;
    font-size: 14px;
    margin: 12px 0;
}

.course-curriculum.navigation h6 {
    font-weight: normal;
    font-size: 13px;
    margin: 10px 0;
}

.course-curriculum .course-curriculum-panel .panel-group {
    margin-bottom: 15px;
    border: 0.1em solid #cecece;
}

.course-curriculum.navigation .course-curriculum-panel .panel-group {
    margin-bottom: 0px;
}

.course-curriculum.navigation .course-curriculum-panel .panel-group {
    border: none;
}

.course-curriculum .course-curriculum-panel .panel-heading {
    background: #FFF;
    padding: 0;
    border-radius: 0;
}

    .course-curriculum .course-curriculum-panel .panel-heading .panel-title {
        margin-top: 0;
        margin-bottom: 0;
        font-size: 16px;
        color: inherit;
    }

    .course-curriculum .course-curriculum-panel .panel-heading .table-content {
        display: block;
        padding: 0;
    }

.course-curriculum.navigation .course-curriculum-panel .panel-heading .table-content {
    padding: 0;
}

.course-curriculum .course-curriculum-panel .panel-heading .table-content > table {
    border-bottom: 1px dotted #cecece;
    padding: 10px;
}

.course-curriculum .course-curriculum-panel .panel:last-child .panel-heading .table-content > table {
    border-bottom: none !important;
}

    table.sub-table {
        width: calc(100% - 20px);
        padding: 0 20px;
        margin: 5px 20px;
    }

    table.sub-table tr td:nth-child(2) {
        padding: 10px 0;
    }

    .course-curriculum .course-curriculum-panel .panel-heading tr {
        font-weight: 500;
        font-size: 13px;
        line-height: 25px;
    }

        .course-curriculum .course-curriculum-panel .panel-heading tr:hover {
            cursor: pointer;
        }

        .course-curriculum.navigation .course-curriculum-panel .panel-heading tr {
            font-size: 12px;
            line-height: 15px;
        }

/*.course-curriculum .course-curriculum-panel .panel-heading tr .file-details {
    opacity: 0;
}

.course-curriculum .course-curriculum-panel .panel-heading tr:hover .file-details {
    opacity: 1;
}*/



.course-curriculum .course-curriculum-panel .panel-heading > table > tr:not(.text-success):hover,
.course-curriculum .course-curriculum-panel .panel-heading > table > tr:not(.text-success):hover .fa-sm .text-primary {
    color: #FE962C !important;
}

.course-curriculum .course-curriculum-panel .panel-heading tr td:nth-child(2) {
    width: 94%;
}

.course-curriculum .course-curriculum-panel .panel-heading tr td:nth-child(3) {
    width: 200px;
    text-align: right;
    display: inline-block;
}

/*.course-curriculum.navigation .course-curriculum-panel .panel-heading tr td:nth-child(3) {
    width: auto;
}*/

.course-curriculum .course-curriculum-panel .panel-body {
    background: #f4f2f2;
    border: none;
    padding: 15px 20px 40px 20px;
    border-radius: 0;
}

    .course-curriculum .course-curriculum-panel .panel-body p {
        margin-bottom: 10px;
    }

.course-curriculum .course-curriculum-panel .panel-heading tr td > div {
    display: inline-block;
    line-height: 24px;
    width: 72px;
    text-align: center;
    color: #fff;
    text-transform: uppercase;
    font-size: 13px;
    margin-right: 80px;
    background-color: #005A85;
}

.course-curriculum .course-curriculum-panel .panel-body a {
    display: block;
    color: #6f6f6f;
    margin-bottom: 5px;
}

    .course-curriculum .course-curriculum-panel .panel-body a i {
        margin-right: 5px;
    }


.course-curriculum .fa-stack {
    font-size: 1em;
}

.course-curriculum .fa-sm .text-primary {
    color: #005A85 !important;
}

/*.course-curriculum .fa-sm.left {
    margin-right: 10px;
}

.course-curriculum .fa-sm.right {
    margin-left: 10px;
}



    .course-curriculum .fa-sm .fa-stack-1x {
        font-size: 1em;
    }

    

.course-curriculum .icon-stack, table .actions .icon-stack {
    position: relative;
    display: inline-block;
    width: 1.7em;
    height: 1.6em;
    line-height: 1.6em;
    vertical-align: middle;
    color: #fff;
    left: -1px;
    cursor: pointer;
}*/

/*table .actions .icon-stack {
    color: #000;
}

.course-curriculum .icon-stack-1x, table .actions .icon-stack-1x,
.course-curriculum .icon-stack-2x, table .actions .icon-stack-2x,
.course-curriculum .icon-stack-3x, table .actions .icon-stack-3x {
    position: absolute;
    left: 0;
    width: 100%;
    text-align: right;
}

.course-curriculum .icon-stack-1x, table .actions .icon-stack-1x {
    top: -7px;
    line-height: inherit;
    background-color: transparent;
    left: -8px;
    font-size: 0.4em;
}

.course-curriculum .icon-stack-2x, table .actions .icon-stack-2x {
    font-size: 0.7em;
    top: -2px;
}

.course-curriculum .icon-stack-3x, table .actions .icon-stack-3x {
    font-size: 1em;
    top: 3px;
    left: -1px;
}*/

@media (max-width: 768px) {
    .row.run-course {
        padding: 15px 25px;
    }

        .row.run-course .course {
            margin-bottom: 20px;
        }

    .nav.list-inline.course li:first-child {
        margin-bottom: 20px;
    }
}

@media only screen and (min-width: 768px) {
    html.fixed .inner-menu {
        position: absolute;
        left: 0;
        top: 0;
        width: 100%;
    }

    /*html.fixed .inner-wrapper {
        padding-top: 60px;
    }*/
}

.sidebar-widget .widget-header .widget-toggle {
    transform: none;
    -webkit-transform: none;
}


    .sidebar-widget .widget-header .widget-toggle:after {
        font-family: 'Font Awesome 5 Pro';
        font-size: 1.3rem;
        font-weight: 600;
        content: "\f107";
        color: #465162;
    }

.sidebar-widget.widget-collapsed .widget-header .widget-toggle:after {
    content: "\f106";
}

.media-gallery ul.mg-folders > li .item-options {
    opacity: 1;
}


.call-to-action.call-to-action-top {
    padding: 15px;
}

.nav.list-inline.course li {
    display: inline-block;
    padding-left: 0;
}

    .nav.list-inline.course li .btn {
        background-color: #cecece;
        border-color: #ececec;
        padding: 6px 20px;
        font-size: 14px;
    }

    .nav.list-inline.course li.active .btn {
        background-color: #006699;
        border-color: #004466;
    }



.call-to-action-btn.details .tabs {
    /*bottom: 0;
        position: absolute;*/
    margin-bottom: 0;
}

/*------------End courses-----------*/
/*-----------Take Test-------------*/
/*div.table-responsive {
    padding-left: 15px;
    padding-right: 15px;
}*/

.table.multiple-choice tr:hover {
    cursor: pointer !important;
}

.panel-help blockquote {
    border: 2px solid #eee !important;
    margin-right: 30px;
    -ms-border-radius: 5px;
    border-radius: 5px;
}

.questions-take p:has(a) {
    display: inline-block !important;
}

.questions-take p:not(:empty) {
    width: 100%;
    overflow: hidden;
    text-overflow: ellipsis;
}

.questions-take p a[href*="http"] {
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: normal;
    -webkit-line-clamp: 1;
    -webkit-box-orient: vertical;
    /*display: -webkit-box !important;*/
}

.dashboard .table-responsive.row {
    margin-right: 0;
    margin-left: 0;
}

.page-header {
    box-shadow: none;
    border-bottom: 1px solid #ccc;
}

    .page-header h2 {
        /*border-bottom: 1px solid #CCC;*/
        border-bottom: none;
        /*font-size: 1.8rem;*/
    }

.imp-wrap {
    margin: 0 auto;
}



.section-padding {
    padding: 45px 0 37.5px;
}


.panel-footer.bg-white {
    background: #fff;
    border-bottom: 0 none;
    border-right: 0 none;
}

.header-left {
    float: left;
    height: 56px;
}

.inner-wrapper.take-test {
    padding-top: 50px !important;
    border-radius: 5px;
}

.course-taking .page-header.bg-white {
    box-shadow: none !important;
    top: 50px !important;
    -webkit-transition: padding .3s ease-in-out;
    -moz-transition: padding .3s ease-in-out;
    -ms-transition: padding .3s ease-in-out;
    -o-transition: padding .3s ease-in-out;
    transition: padding .3s ease-in-out;
}


.course-taking #content-overlay {
    height: calc(100vh - 50px);
}

.page-header.bg-white {
    background: #FFF;
    border-left: 1px solid #CECECE;
}



    .page-header.bg-white h2 {
        color: #000;
    }




.countdown-row {
    clear: both;
    width: 100%;
    padding: 0px 2px;
    text-align: center;
}


    .countdown-row .countdown-section {
        width: 32.5%;
        padding: 16px 0;
        display: block;
        float: left;
        font-size: 75%;
        text-align: center;
    }

    .countdown-row .countdown-amount {
        font-size: 200%;
    }

    .countdown-row .countdown-period {
        display: block;
    }


.navigation-block {
    width: 20px !important;
    height: 20px !important;
    line-height: 20px !important;
    font-size: 10px !important;
    text-align: center;
    display: inline-block;
    background-color: #bdbdbd;
    border-radius: 15px;
}

.content-details {
    float: left;
    list-style: none;
    padding: 5px 0 9px 0;
    margin: 0;
}

    .content-details li {
        float: left;
        padding: 0 10px;
    }

        .content-details li:not(:last-child) {
            border-right: 1px solid #e0e0e0;
        }

        .content-details li h5 {
            font-size: 1rem;
            margin: 0;
        }

        .content-details li h4 {
            display: block;
            margin: 0;
            line-height: 1.4;
            font-weight: 600;
        }

.userbox .name-test {
    font-size: 2.4rem;
    line-height: 2.2em;
    color: #fff;
}

/*@media only screen and (min-width: 768px) and (max-width: 1199px) {
    .text-truncate.resize {
        width: 50%;
    }
}

@media only screen and (min-width : 1224px) {
    .text-truncate.resize {
        width: 750px;
    }
}


@media only screen and (min-width : 1824px) {
    .text-truncate.resize {
        width: 1450px;
    }
}*/


.page-header .breadcrumbs li:not(:first-child) {
    border-left: 1px solid #c3c3c3;
}

.page-header .breadcrumbs li {
    padding: 0 15px;
}

    .page-header .breadcrumbs li:after {
        content: none;
    }


/*.hours:not(.uib-increment, .uib-decrement):after,
.minutes:not(.uib-increment, .uib-decrement):after {
    content: ":";
    padding-left: 5px;
}*/

.hours:not(.uib-increment):not(.uib-decrement):not(.uib-time):after,
.minutes:not(.uib-increment):not(.uib-decrement):not(.uib-time):after,
.seconds:not(.uib-increment):not(.uib-decrement):not(.uib-time):not(.text-weight-bold):after {
    content: ":";
    padding-left: 5px;
}

.sidebar-right-wrapper .side-header-right {
    position: relative;
    color: #777;
    height: 50px;
}



    .sidebar-right-wrapper .side-header-right .sidebar-title {
        color: #465162;
        padding: 15px;
        font-size: 1.3rem;
    }

    .sidebar-right-wrapper .side-header-right .sidebar-toggle {
        position: absolute;
        top: 0;
        /*right: -15px;
        width: 73px;*/
        height: 50px;
        border-radius: 0 0 0 5px;
        text-align: center;
        cursor: pointer;
    }

        .sidebar-right-wrapper .side-header-right .sidebar-toggle i {
            color: #C3C3C3;
            font-size: 2.2rem;
            line-height: 50px;
            -webkit-transition: all 0.15s ease-in-out;
            -moz-transition: all 0.15s ease-in-out;
            transition: all 0.15s ease-in-out;
        }




.nav-legends {
    display: inline-block;
    margin: 0 auto;
}

.nav.nav-legends > li {
    float: left;
}

    .nav.nav-legends > li a:hover {
        background: #fff;
    }


/*html.sidebar-right-opened:not(.sidebar-rigth-collapsed) .navigation-bottom {
    display: none;
}

html.sidebar-right-opened.sidebar-rigth-collapsed .navigation-bottom {
    display: block;
}*/

html.sidebar-right-opened .navigation-block {
    cursor: pointer;
}

/*-------End take test------------*/

/*-------DragMatching------------*/
.drag-matching .panel-featured {
    border-style: solid;
    border-width: 1px;
    min-height: 55px;
    background: #fff;
    border-radius: 5px;
}

    .drag-matching .panel-featured .panel-body {
        cursor: all-scroll;
    }

.drag-matching .portlet-placeholder {
    border: 1px dashed #dddddd;
    background: #CFCFCF;
}

.drag-matching .left-content .panel-body {
    background: rgb(246, 246, 246);
    border-radius: 5px;
}

.drag-matching .portlet-placeholder .panel-heading {
    background: transparent !important;
}

.drag-matching .right-content div.panel-heading {
    border-radius: 5px 5px 0 0;
    padding: 15px;
}


    .drag-matching .right-content div.panel-heading:only-child {
        border-radius: 5px;
        border-bottom: none;
    }

/*-------------Drag to paragraph-------*/



/*new*/

.drag-to-paragraph .panel-featured {
    border-style: solid;
    border-width: 1px;
    min-height: 25px;
    background: #fff;
    -ms-border-radius: 5px;
    border-radius: 5px;
    display: inline-block;
}

    .drag-to-paragraph .panel-featured .panel-body {
        cursor: all-scroll;
    }

.drag-to-paragraph .portlet-placeholder {
    border: 1px dashed #dddddd;
    background: #CFCFCF;
    margin-bottom: 0;
}

.drag-to-paragraph .left-content .panel-body {
    background: rgb(246, 246, 246);
    border-radius: 5px;
}


.drag-to-paragraph .right-content .panel-featured {
    width: 100px;
}

.drag-to-paragraph hr {
    -webkit-box-sizing: border-box;
    -moz-box-sizing: border-box;
    box-sizing: border-box;
    border: none;
    background: #cecece;
}


.drag-to-paragraph .drag-container {
    width: 150px;
    display: inline;
}

.drag-to-paragraph .left-content .dragzones {
    cursor: move;
}

.drag-to-paragraph .dragzones {
    padding: 0 5px;
}

.drag-to-paragraph .occupied {
    width: auto !important;
    cursor: default;
    border-left: none !important;
    border-right: none !important;
    border-top: none !important;
    border-radius: 0 !important;
}

.drag-to-paragraph .ui-draggable-dragging {
    box-shadow: 0 0 2px #000;
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: normal;
    -webkit-line-clamp: 1;
    -webkit-box-orient: vertical;
    display: -webkit-box !important;
    width: 120px;
    cursor: move;
}




.min-width-50 {
    min-width: 50px;
}

/*.numberQuestion {
    float: left;
    margin-right: 5px !important;
    margin-bottom: 5px;
}

.numberQuestionName {
    width: 160px !important;
    float: left;
}*/

.crear-both {
    clear: both;
}

/*****Media query de Take test*/
@media only screen and (max-width: 767px) {
    .editresolution {
        margin-right: 50px !important;
        background: #FFF;
        margin-top: 176px;
        position: absolute;
    }

    .breadcrumbs {
        display: block !important;
    }

    .mr-50 {
        margin-right: 50px !important;
    }

    .inner-wrapper.take-test {
        padding-top: 0px !important;
        border-radius: 5px;
    }
}


ul.nav-main li.nav-parent > a.special-count:after {
    content: none;
}

/*********************************/
html body .tabs.tabs-simple .nav-tabs > li.active a, html.dark body .tabs.tabs-simple .nav-tabs > li.active a, html body .tabs.tabs-simple .nav-tabs > li.active a:focus, html.dark body .tabs.tabs-simple .nav-tabs > li.active a:focus, html body .tabs.tabs-simple .nav-tabs > li a:hover, html.dark body .tabs.tabs-simple .nav-tabs > li a:hover, html body .tabs.tabs-simple .nav-tabs > li.active a:hover, html.dark body .tabs.tabs-simple .nav-tabs > li.active a:hover {
    border-top-color: #0088cc;
    color: #0088cc;
}

html body .tabs.tabs-bottom .nav-tabs li a:hover, html.dark body .tabs.tabs-bottom .nav-tabs li a:hover, html body .tabs.tabs-bottom .nav-tabs li.active a, html.dark body .tabs.tabs-bottom .nav-tabs li.active a, html body .tabs.tabs-bottom .nav-tabs li.active a:hover, html.dark body .tabs.tabs-bottom .nav-tabs li.active a:hover, html body .tabs.tabs-bottom .nav-tabs li.active a:focus, html.dark body .tabs.tabs-bottom .nav-tabs li.active a:focus {
    border-bottom-color: #0088cc;
}

.thumb-info .thumb-info-type {
    background-color: #0088cc;
}

.thumb-info .thumb-info-action-icon {
    background-color: #0088cc;
}

.thumb-info-social-icons a.icons {
    background-color: #0088cc;
}

.thumbnail .zoom {
    background-color: #0088cc;
}

.img-thumbnail .zoom {
    background-color: #0088cc;
}

html .thumb-info .thumb-info-action-icon-primary {
    background-color: #0088cc;
}

    html .thumb-info .thumb-info-action-icon-primary i {
        color: #ffffff;
    }

html .thumb-info .thumb-info-action-icon-secondary {
    background-color: #e36159;
}

    html .thumb-info .thumb-info-action-icon-secondary i {
        color: #ffffff;
    }

html .thumb-info .thumb-info-action-icon-tertiary {
    background-color: #2baab1;
}

    html .thumb-info .thumb-info-action-icon-tertiary i {
        color: #ffffff;
    }

html .thumb-info .thumb-info-action-icon-quaternary {
    background-color: #ed9c28;
}

    html .thumb-info .thumb-info-action-icon-quaternary i {
        color: #ffffff;
    }

html .thumb-info .thumb-info-action-icon-dark {
    background-color: #2e353e;
}

    html .thumb-info .thumb-info-action-icon-dark i {
        color: #ffffff;
    }

html .thumb-info .thumb-info-action-icon-light {
    background-color: #ffffff;
}

    html .thumb-info .thumb-info-action-icon-light i {
        color: #777777;
    }

.thumb-info-ribbon {
    background: #0088cc;
}

    .thumb-info-ribbon:before {
        border-right-color: #005580;
        border-left-color: #005580;
    }

    .thumb-info-ribbon:before {
        border-right-color: #005580;
        border-left-color: #005580;
    }

/*----------------------------- Start - Styles for Resources Website----------------------------------*/
.vertical-icons {
    display: block;
    vertical-align: middle;
}

@media only screen and (min-width: 1200px) {
    html.boxed.resources .inner-wrapper {
        padding-top: 85px;
    }
}

/*----------------------------- End -  Styles for Resources Website----------------------------------*/

/******PROGRES BAR**********/
.progress-xst {
    height: 2px;
}

    .progress-xst, .progress-xst .progress-bar {
        border-radius: 4px;
    }

        .progress-xst .progress-bar {
            direction: ltr !important;
            text-indent: -9999px;
        }

        .progress-xst.progress-half-rounded, .progress-xst.progress-half-rounded .progress-bar {
            border-radius: 1px;
        }

        .progress-xst.progress-striped .progress-bar {
            background-size: 7px 7px;
        }


.progress-text {
    margin-left: 3px !important;
}

.ct-golden-section:before {
    padding-bottom: 20% !important;
}

.ct-golden-section:after {
    padding-bottom: 30px !important;
}

.ct-end {
    position: relative;
    left: -10px;
    /*top: 10px;*/
    font-size: 10px !important;
    font-weight: bold;
    -webkit-transform: rotate(55deg);
    -moz-transform: rotate(55deg);
    -o-transform: rotate(55deg);
    max-width: 0px !important;
}

.ct-legend .ct-series-0:before {
    margin-top: 5px !important;
}

.ct-legend .ct-series-1:before {
    margin-top: 5px !important;
}

.modal.in {
    padding-top: 70px;
}


/* Font Size */
.font-size-xs {
    font-size: 0.8em !important;
}

.font-size-sm {
    font-size: 0.9em !important;
}

.font-size-md {
    font-size: 1em !important;
}

.font-size-lg {
    font-size: 1.1em !important;
}

.font-size-xl {
    font-size: 1.2em !important;
}

.font-bold {
    font-weight: bold;
}

/*Galery Image*/
/* Masonry Loading */
.masonry-loader {
    height: auto;
    overflow: visible;
    position: relative;
}

    .masonry-loader:after {
        -webkit-transition: all 0.5s;
        -moz-transition: all 0.5s;
        transition: all 0.5s;
        content: ' ';
        background: #FFF;
        bottom: 0;
        left: 0;
        position: absolute;
        right: 0;
        top: 0;
        z-index: 1;
        opacity: 0;
    }

    .masonry-loader .bounce-loader {
        display: none;
    }

    .masonry-loader.masonry-loader-showing {
        height: 200px;
        overflow: hidden;
    }

        .masonry-loader.masonry-loader-showing:after {
            opacity: 1;
        }

        .masonry-loader.masonry-loader-showing .bounce-loader {
            display: block;
        }

    .masonry-loader.masonry-loader-loaded:after {
        display: none;
    }

/* Mockup */
@media (min-width: 992px) {
    .mockup-landing-page {
        margin-top: -120px;
    }
}
/* List */
.list li {
    margin-bottom: 13px;
}

.list.pull-left li {
    text-align: left;
}

.list.list-icons {
    list-style: none;
    padding-left: 0;
    padding-right: 0;
}

    .list.list-icons li {
        position: relative;
        padding-left: 25px;
    }

        .list.list-icons li > .fa:first-child,
        .list.list-icons li > .icons:first-child, .list.list-icons li a:first-child > .fa:first-child,
        .list.list-icons li a:first-child > .icons:first-child {
            position: absolute;
            left: 0;
            top: 5px;
        }

    .list.list-icons.list-icons-style-2 li {
        padding-top: 5px;
        padding-left: 36px;
    }

        .list.list-icons.list-icons-style-2 li > .fa:first-child,
        .list.list-icons.list-icons-style-2 li > .icons:first-child, .list.list-icons.list-icons-style-2 li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-style-2 li a:first-child > .icons:first-child {
            border-width: 1px;
            border-style: solid;
            border-radius: 50%;
            width: 25px;
            height: 25px;
            text-align: center;
            padding: 4px;
        }

    .list.list-icons.list-icons-style-3 li {
        padding-top: 5px;
        padding-left: 36px;
    }

        .list.list-icons.list-icons-style-3 li > .fa:first-child,
        .list.list-icons.list-icons-style-3 li > .icons:first-child, .list.list-icons.list-icons-style-3 li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-style-3 li a:first-child > .icons:first-child {
            color: #FFF;
            border-radius: 50%;
            width: 25px;
            height: 25px;
            text-align: center;
            padding: 5px;
        }

    .list.list-icons.list-icons-sm li {
        padding-left: 13px;
        margin-bottom: 5px;
    }

        .list.list-icons.list-icons-sm li > .fa:first-child,
        .list.list-icons.list-icons-sm li > .icons:first-child, .list.list-icons.list-icons-sm li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-sm li a:first-child > .icons:first-child {
            font-size: 0.8em;
            top: 7px;
        }

    .list.list-icons.list-icons-sm.list-icons-style-2 li {
        padding-left: 32px;
    }

        .list.list-icons.list-icons-sm.list-icons-style-2 li > .fa:first-child,
        .list.list-icons.list-icons-sm.list-icons-style-2 li > .icons:first-child, .list.list-icons.list-icons-sm.list-icons-style-2 li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-sm.list-icons-style-2 li a:first-child > .icons:first-child {
            width: 20px;
            height: 20px;
            padding: 3px;
        }

    .list.list-icons.list-icons-sm.list-icons-style-3 li {
        padding-left: 32px;
    }

        .list.list-icons.list-icons-sm.list-icons-style-3 li > .fa:first-child,
        .list.list-icons.list-icons-sm.list-icons-style-3 li > .icons:first-child, .list.list-icons.list-icons-sm.list-icons-style-3 li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-sm.list-icons-style-3 li a:first-child > .icons:first-child {
            width: 20px;
            height: 20px;
            padding: 3px;
        }

    .list.list-icons.list-icons-lg li {
        padding-top: 5px;
        padding-left: 32px;
    }

        .list.list-icons.list-icons-lg li > .fa:first-child,
        .list.list-icons.list-icons-lg li > .icons:first-child, .list.list-icons.list-icons-lg li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-lg li a:first-child > .icons:first-child {
            font-size: 1.5em;
        }

    .list.list-icons.list-icons-lg.list-icons-style-2 li {
        padding-top: 8px;
        padding-left: 42px;
    }

        .list.list-icons.list-icons-lg.list-icons-style-2 li > .fa:first-child,
        .list.list-icons.list-icons-lg.list-icons-style-2 li > .icons:first-child, .list.list-icons.list-icons-lg.list-icons-style-2 li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-lg.list-icons-style-2 li a:first-child > .icons:first-child {
            width: 30px;
            height: 30px;
            padding: 4px;
        }

    .list.list-icons.list-icons-lg.list-icons-style-3 li {
        padding-top: 8px;
        padding-left: 42px;
    }

        .list.list-icons.list-icons-lg.list-icons-style-3 li > .fa:first-child,
        .list.list-icons.list-icons-lg.list-icons-style-3 li > .icons:first-child, .list.list-icons.list-icons-lg.list-icons-style-3 li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-lg.list-icons-style-3 li a:first-child > .icons:first-child {
            width: 30px;
            height: 30px;
            padding: 4px;
        }

    .list.list-icons.list-icons-reverse li {
        text-align: right;
        padding-right: 25px;
        padding-left: 0;
    }

        .list.list-icons.list-icons-reverse li > .fa:first-child,
        .list.list-icons.list-icons-reverse li > .icons:first-child, .list.list-icons.list-icons-reverse li a:first-child > .fa:first-child,
        .list.list-icons.list-icons-reverse li a:first-child > .icons:first-child {
            position: absolute;
            left: auto;
            right: 0;
            top: 5px;
        }

    .list.list-icons.list-icons-reverse.list-icons-style-2 li {
        padding-right: 36px;
    }

    .list.list-icons.list-icons-reverse.list-icons-style-3 li {
        padding-right: 36px;
    }

    .list.list-icons.list-icons-reverse.list-icons-sm li {
        padding-left: 0;
        padding-right: 13px;
    }

    .list.list-icons.list-icons-reverse.list-icons-sm.list-icons-style-2 li {
        padding-right: 32px;
    }

    .list.list-icons.list-icons-reverse.list-icons-sm.list-icons-style-3 li {
        padding-right: 32px;
    }

    .list.list-icons.list-icons-reverse.list-icons-lg li {
        padding-left: 0;
        padding-right: 32px;
    }

    .list.list-icons.list-icons-reverse.list-icons-lg.list-icons-style-2 li {
        padding-right: 42px;
    }

    .list.list-icons.list-icons-reverse.list-icons-lg.list-icons-style-3 li {
        padding-right: 42px;
    }

.list.list-borders li {
    /*border-bottom: 1px solid #DBDBDB;*/
    margin-top: 9px;
    margin-bottom: 0;
    padding-bottom: 9px;
}

/*.list.list-borders li:last-child {
        border-bottom: 0;
    }*/

.list.list-side-borders {
    border-left: 1px solid #DBDBDB;
    padding-left: 10px;
}

.list.list-ordened {
    counter-reset: custom-counter;
    list-style: none;
}

    .list.list-ordened li {
        position: relative;
        padding-left: 22px;
    }

        .list.list-ordened li:before {
            position: absolute;
            top: 0;
            left: 0;
            content: counter(custom-counter);
            counter-increment: custom-counter;
            font-weight: bold;
        }

    .list.list-ordened.list-ordened-style-2 li, .list.list-ordened.list-ordened-style-3 li {
        padding-left: 32px;
    }

        .list.list-ordened.list-ordened-style-2 li:before, .list.list-ordened.list-ordened-style-3 li:before {
            border-radius: 100%;
            border-style: solid;
            border-width: 1px;
            min-width: 26px;
            padding: 0;
            text-align: center;
        }

        .list.list-ordened.list-ordened-style-3 li:before {
            color: #FFF;
            border: 0;
        }

.list.list-unstyled {
    padding-left: 0;
    padding-right: 0;
}

dl dd {
    margin-bottom: 15px;
}

/* Sitemap */
ul.sitemap > li > a {
    font-weight: bold;
}

ul.sitemap.list li {
    margin: 0 0 3px 0;
}

ul.sitemap.list ul {
    margin-bottom: 5px;
    margin-top: 5px;
}

/*Mansory Elements*/
/* Responsive */
@media (max-width: 991px) {
    .thumbnail {
        border: 0;
        text-align: center;
    }
}
/* Masonry Loading */
.masonry-loader {
    height: auto;
    overflow: visible;
    position: relative;
}

    .masonry-loader:after {
        -webkit-transition: all 0.5s;
        -moz-transition: all 0.5s;
        transition: all 0.5s;
        content: ' ';
        background: #FFF;
        bottom: 0;
        left: 0;
        position: absolute;
        right: 0;
        top: 0;
        z-index: 1;
        opacity: 0;
    }

    .masonry-loader .bounce-loader {
        display: none;
    }

    .masonry-loader.masonry-loader-showing {
        height: 200px;
        overflow: hidden;
    }

        .masonry-loader.masonry-loader-showing:after {
            opacity: 1;
        }

        .masonry-loader.masonry-loader-showing .bounce-loader {
            display: block;
        }

    .masonry-loader.masonry-loader-loaded:after {
        display: none;
    }



/*****Mansory elements*/
/* Image Gallery */
ul.image-gallery {
    list-style: none;
    margin: 0;
    padding: 0;
}

    ul.image-gallery .image-gallery-item {
        margin-bottom: 35px;
    }

/* Thumbnail Gallery */
ul.thumbnail-gallery {
    list-style: none;
    margin: 10px 0;
    padding: 0;
}

    ul.thumbnail-gallery li {
        display: inline-block;
        margin: 10px 10px 0 0;
        padding: 0;
    }

/* Responsive */
@media (max-width: 991px) {
    .thumbnail {
        border: 0;
        text-align: center;
    }
}
/* Masonry */
.masonry .masonry-item {
    width: 20%;
}

    .masonry .masonry-item.w2 {
        width: 50%;
    }



    .masonry .masonry-item img {
        border-radius: 0 !important;
    }

/* Masonry Loading */
.masonry-loader {
    height: auto;
    overflow: visible;
    position: relative;
}

    .masonry-loader:after {
        -webkit-transition: all 0.5s;
        -moz-transition: all 0.5s;
        transition: all 0.5s;
        content: ' ';
        background: #FFF;
        bottom: 0;
        left: 0;
        position: absolute;
        right: 0;
        top: 0;
        z-index: 1;
        opacity: 0;
    }

    .masonry-loader .bounce-loader {
        display: none;
    }

    .masonry-loader.masonry-loader-showing {
        height: 200px;
        overflow: hidden;
    }

        .masonry-loader.masonry-loader-showing:after {
            opacity: 1;
        }

        .masonry-loader.masonry-loader-showing .bounce-loader {
            display: block;
        }

    .masonry-loader.masonry-loader-loaded:after {
        display: none;
    }

/* Mockup */
@media (min-width: 992px) {
    .mockup-landing-page {
        margin-top: -120px;
    }
}

dl dd {
    margin-bottom: 15px;
}


/****View Summary result test******/
.usedborder {
    border-left: 1px solid #e1e1e1 !important;
}


/* Timeline */
section.timeline {
    width: 75%;
    margin: 50px 12.5% 0;
    position: relative;
    float: left;
    padding-bottom: 120px;
}

    section.timeline:after {
        background: #505050;
        background: -moz-linear-gradient(top, rgba(80, 80, 80, 0) 0%, #505050 8%, #505050 92%, rgba(80, 80, 80, 0) 100%);
        background: -webkit-gradient(linear, left top, left bottom, color-stop(0%, #1e5799), color-stop(100%, #7db9e8));
        background: -webkit-linear-gradient(top, rgba(80, 80, 80, 0) 0%, #505050 8%, #505050 92%, rgba(80, 80, 80, 0) 100%);
        background: -o-linear-gradient(top, rgba(80, 80, 80, 0) 0%, #505050 8%, #505050 92%, rgba(80, 80, 80, 0) 100%);
        background: -ms-linear-gradient(top, rgba(80, 80, 80, 0) 0%, #505050 8%, #505050 92%, rgba(80, 80, 80, 0) 100%);
        background: linear-gradient(to bottom, rgba(80, 80, 80, 0) 0%, #505050 8%, #505050 92%, rgba(80, 80, 80, 0) 100%);
        content: "";
        display: block;
        height: 100%;
        left: 50%;
        margin-left: -2px;
        position: absolute;
        top: -60px;
        width: 3px;
        z-index: 0;
        filter: alpha(opacity=35);
        opacity: 0.35;
    }

    section.timeline .timeline-date {
        box-shadow: 0 1px 5px 0 rgba(0, 0, 0, 0.04);
        position: relative;
        display: block;
        clear: both;
        width: 200px;
        height: 45px;
        padding: 5px;
        border: 1px solid #E5E5E5;
        margin: 0 auto 10px;
        text-shadow: 0 1px 1px #fff;
        border-radius: 4px;
        background: #FFF;
        z-index: 1;
    }

        section.timeline .timeline-date h3 {
            display: block;
            text-align: center;
            color: #757575;
            font-size: 0.9em;
            line-height: 32px;
        }

    section.timeline .timeline-title {
        background: #F4F4F4;
        padding: 12px;
    }

        section.timeline .timeline-title h4 {
            padding: 0;
            margin: 0;
            color: #171717;
            font-size: 1.4em;
        }

        section.timeline .timeline-title a {
            color: #171717;
        }

        section.timeline .timeline-title .timeline-title-tags {
            color: #B1B1B1;
            font-size: 0.9em;
        }

            section.timeline .timeline-title .timeline-title-tags a {
                color: #B1B1B1;
                font-size: 0.9em;
            }

    section.timeline .timeline-box {
        box-shadow: 0 1px 5px 0 rgba(0, 0, 0, 0.04);
        border: 1px solid #E5E5E5;
        border-radius: 4px;
        margin: 20px 10px 10px 10px;
        padding: 10px;
        position: relative;
        width: 45.7%;
        float: left;
        z-index: 1;
        margin-bottom: 30px;
        /*background: #FFF;*/
        background: #005a85;
    }

        section.timeline .timeline-box.left {
            clear: both;
        }

            section.timeline .timeline-box.left:before {
                background: none repeat scroll 0 0 #E5E5E5;
                border-radius: 50%;
                box-shadow: 0 0 0 3px #FFF, 0 0 0 6px #E5E5E5;
                content: "";
                display: block;
                height: 7px;
                margin-right: -5px;
                position: absolute;
                right: -6.8%;
                top: 22px;
                width: 8px;
            }

            section.timeline .timeline-box.left:after {
                -webkit-transform: rotate(45deg);
                -moz-transform: rotate(45deg);
                -ms-transform: rotate(45deg);
                -o-transform: rotate(45deg);
                transform: rotate(45deg);
                background: #FFF;
                border-right: 1px solid #E5E5E5;
                border-top: 1px solid #E5E5E5;
                content: "";
                display: block;
                height: 14px;
                position: absolute;
                right: -8px;
                top: 20px;
                width: 14px;
                z-index: 0;
            }

        section.timeline .timeline-box.right {
            clear: right;
            float: right;
            right: -1px;
            margin-top: 40px;
        }

            section.timeline .timeline-box.right:before {
                background: none repeat scroll 0 0 #E5E5E5;
                border-radius: 50%;
                box-shadow: 0 0 0 3px #FFF, 0 0 0 6px #E5E5E5;
                content: "";
                display: block;
                height: 7px;
                margin-left: -5px;
                position: absolute;
                left: -7.2%;
                top: 32px;
                width: 8px;
            }

            section.timeline .timeline-box.right:after {
                -webkit-transform: rotate(45deg);
                -moz-transform: rotate(45deg);
                -ms-transform: rotate(45deg);
                -o-transform: rotate(45deg);
                transform: rotate(45deg);
                background: #FFF;
                border-left: 1px solid #E5E5E5;
                border-bottom: 1px solid #E5E5E5;
                content: "";
                display: block;
                height: 14px;
                position: absolute;
                left: -8px;
                top: 30px;
                width: 14px;
                z-index: 0;
            }

        section.timeline .timeline-box .owl-carousel {
            border-radius: 0;
            padding: 0;
            border: 0;
            box-shadow: none;
        }

/* Responsive */
@media (max-width: 991px) {
    section.timeline .timeline-box {
        float: none;
        clear: both;
        right: auto;
        left: auto;
        margin: 25px auto;
        max-width: 70%;
        width: auto;
    }

        section.timeline .timeline-box.right {
            float: none;
            clear: both;
            right: auto;
            left: auto;
            margin: 25px auto;
            max-width: 70%;
            width: auto;
        }

            section.timeline .timeline-box.left:after, section.timeline .timeline-box.right:after, section.timeline .timeline-box.left:before, section.timeline .timeline-box.right:before {
                display: none;
            }
}

@media (max-width: 479px) {
    section.timeline {
        width: auto;
        float: none;
        margin-left: 0;
        margin-right: 0;
    }

        section.timeline .timeline-box {
            margin: 15px auto;
            max-width: 90%;
        }

            section.timeline .timeline-box.right {
                margin: 15px auto;
                max-width: 90%;
            }

    article.post-large {
        margin-left: 0;
    }

        article.post-large .post-image, article.post-large .post-date {
            margin-left: 0;
        }
}


/*---Custom Fonts */

.font-weight-light {
    font-weight: 300 !important;
}

.font-weight-normal {
    font-weight: 400 !important;
}

.font-weight-semibold {
    font-weight: 600 !important;
}

.font-weight-bold {
    font-weight: 700 !important;
}

.font-weight-extra-bold {
    font-weight: 900 !important;
}



/***Button Play un audio***/
body .btn-borders.btn-primary.Play {
    border-color: #0088CC !important;
    color: #0088CC;
}

/****Preview Upload video ****/

span video {
    margin-top: 10px;
    max-height: 90px !important;
}

span audio {
    margin-top: 55px;
}

/****BLock section Answer in answered questions  ****/


.blockAnswer {
    z-index: 0 !important;
    background-color: rgb(0,0,0);
    background-color: rgba(252, 252, 252, 0.3);
    transition: 0.5s;
    pointer-events: none !important;
}


.blockAnswerHS > #image-map-pro-container > .imp-wrap > .imp-shape-container > * {
    z-index: 0 !important;
    background-color: rgb(0,0,0);
    background-color: rgba(252, 252, 252, 0.3);
    transition: 0.5s;
    pointer-events: none !important;
}

/* Container With Sidebar - Sidebar Collapsed */
@media (min-width: 768px) and (max-width: 991px) {
    .container-with-sidebar {
        width: 100%;
    }
}

/* Container With Sidebar */
@media (min-width: 768px) and (max-width: 1199px) {
    html:not(.sidebar-left-collapsed):not(.boxed) .container-with-sidebar {
        width: 100%;
    }

        html:not(.sidebar-left-collapsed):not(.boxed) .container-with-sidebar [class*="col-"]:not(.isotope-item) {
            width: 100%;
        }
}

@media (min-width: 992px) {
    html:not(.sidebar-left-collapsed):not(.boxed) .container-with-sidebar {
        width: 100%;
    }
}

@media (min-width: 1200px) {
    html:not(.sidebar-left-collapsed):not(.boxed) .container-with-sidebar {
        width: 100%;
    }
}


/* ---------------------------------------------------------------------- */
/*  Subview
/* ---------------------------------------------------------------------- */
/* line 4, ../sass/partials/_subview.scss */
.subviews {
    background-color: #FFFFFF;
    position: absolute;
    right: 0;
    top: 0;
    z-index: 501;
    display: none;
    overflow-y: auto;
    -moz-transition: all 0.3s ease-in-out;
    -o-transition: all 0.3s ease-in-out;
    -webkit-transition: all 0.3s ease-in-out;
    -ms-transition: all 0.3s ease-in-out;
    transition: all 0.3s ease-in-out;
}

/* line 14, ../sass/partials/_subview.scss */
.subviews-top {
    height: 0;
    left: 0;
}

/* line 18, ../sass/partials/_subview.scss */
.subviews-right {
    width: 0;
    left: auto;
    right: 0;
}

/*Summernote*/
.note-custom button {
    background-color: #47a447;
    border-color: #47a447;
    color: #fff;
}
    .note-custom button:hover {
        color: #ffffff !important;
        border-color: #51b451 !important;
        background-color: #51b451 !important;
    }

/**Courses Settings **/
.top-0 {
    top: 0 !important;
}

.right-0 {
    right: 0 !important;
}

/*** icon to  input in course Overview***/
.delete-input {
    position: absolute;
    top: 40%;
    right: 10px;
    margin-top: -15px;
    color: #999999;
    -ms-opacity: 0;
    opacity: 0;
}

.zidex100 {
    z-index: 100 !important;
}

.inputFillInTheBlank {
    right: 9px !important;
    z-index: 10;
}

.input-features:hover .delete-input {
    opacity: 1;
}

div.has-error > a.delete-input {
    top: 30% !important;
}

html > body .ui-pnotify {
    z-index: 10001;
}

.width-Auto {
    width: auto !important;
}


.form-control.password {
    -webkit-text-security: disc;
}


/****layout contet in course*****/
.panel-heading-content {
    background: #ededed !important;
    padding: 0;
    border-radius: 0;
}

.color-inherit {
    color: inherit !important;
}

.content-accordion {
    width: 100% !important;
}

    .content-accordion tr {
        font-weight: 600 !important;
        font-size: 14px !important;
        line-height: 25px !important;
        display: table-row;
        vertical-align: inherit;
        border-color: inherit;
        color: inherit;
    }

.panel-heading-content tr td:nth-child(1) {
    width: 64%;
}

.p-color-bg {
    background: #00aadc;
}

.panel-heading-content tr td span {
    font-size: 13px;
    text-transform: uppercase;
    color: #333333;
    margin-left: 35px;
    position: relative;
    padding-right: 10px;
}

.panel-heading-content tr td:nth-child(3) {
    width: 80px;
    text-align: right;
}

.panel-heading-content td, th {
    display: table-cell;
    vertical-align: inherit;
}

.panel-heading-content tr {
    font-weight: 600;
    font-size: 14px;
    line-height: 25px;
}

    .panel-heading-content tr td > div {
        display: inline-block;
        line-height: 24px;
        width: 72px;
        text-align: center;
        color: #fff;
        text-transform: uppercase;
        font-size: 13px;
        margin-right: 80px;
    }

.owl-carousel {
    margin-bottom: 20px;
}

    .owl-carousel .owl-nav {
        top: 50%;
        position: absolute;
        margin-top: -20px;
        width: 100%;
    }

    .owl-carousel.show-nav-hover .owl-nav {
        opacity: 0;
        -webkit-transition: opacity 0.2s ease-in-out;
        -moz-transition: opacity 0.2s ease-in-out;
        transition: opacity 0.2s ease-in-out;
    }

    .owl-carousel.show-nav-title .owl-nav {
        top: 0;
        right: 0;
        margin-top: -45px;
        width: auto;
    }

        .owl-carousel.show-nav-title .owl-nav [class*="owl-"], .owl-carousel.show-nav-title .owl-nav [class*="owl-"]:hover, .owl-carousel.show-nav-title .owl-nav [class*="owl-"]:active {
            font-size: 18px;
            background: transparent !important;
            width: 18px;
            font-size: 18px;
        }

        .owl-carousel.show-nav-title .owl-nav .owl-prev {
            left: -45px;
        }

        .owl-carousel.show-nav-title .owl-nav [class*="owl-"] {
            color: #0088cc;
        }

            .owl-carousel.show-nav-title .owl-nav [class*="owl-"]:hover,
            .owl-carousel.show-nav-title .owl-nav [class*="owl-"].hover {
                color: #0088cc;
            }

    .owl-carousel.show-nav-hover:hover .owl-nav {
        opacity: 1;
    }

    .owl-carousel .owl-nav [class*="owl-"] {
        background-color: #00aadc;
        border-color: #0077b3;
        color: #ffffff;
    }

        .owl-carousel .owl-nav [class*="owl-"]:hover,
        .owl-carousel .owl-nav [class*="owl-"].hover {
            background-color: #0099e6;
            border-color: #0087be;
            color: #ffffff;
        }

        .owl-carousel .owl-nav [class*="owl-"]:active,
        .owl-carousel .owl-nav [class*="owl-"].active {
            background-color: #0099e6;
            background-image: none;
            border-color: #0087be;
        }

    .owl-carousel .owl-nav .owl-prev, .owl-carousel .owl-nav .owl-next {
        display: inline-block;
        position: absolute;
        width: 30px;
        height: 30px;
    }

    .owl-carousel .owl-nav .owl-prev {
        left: -5px;
    }

    .owl-carousel.show-nav-hover .owl-nav .owl-prev {
        left: -20px;
    }

    .owl-carousel .owl-nav .owl-prev:before {
        font-family: 'Font Awesome 5 Pro';
        content: "\f053";
        position: relative;
        left: -1px;
        top: 1px;
    }

    .owl-carousel.show-nav-hover .owl-nav .owl-next {
        right: -20px;
    }

    .owl-carousel .owl-nav .owl-next {
        right: -5px;
    }

        .owl-carousel .owl-nav .owl-next:before {
            font-family: 'Font Awesome 5 Pro';
            content: "\f054";
            position: relative;
            left: 2px;
            top: 1px;
        }



    .mfp-close, .mfp-close-btn-in .mfp-close,
    .owl-carousel .owl-item img {
        cursor: pointer !important;
    }

.panel-body-login-outlogo {
    background: #fdfdfd;
    -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
    box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
    border-radius: 5px;
}

.br-none {
    border-radius: 0 !important;
}

.bl-none {
    border-left: none !important;
}

.br-none {
    border-right: none !important;
}

.bb-none {
    border-bottom: none !important;
}

.bb-gray {
    border-bottom: 1px solid;
}

.bt-none {
    border-top: none !important;
}

.bl-simple {
    border-left: 1px solid #ccc !important;
}

.fl-none {
    float: none !important;
}


.removeDrag {
    height: 26px;
    cursor: pointer;
    text-align: center;
    /*line-height: 26px;
    font-size: 20px;*/
    top: 0;
    right: 0;
    margin-left: 3px;
    opacity: 0;
}


.customalert {
    margin: 0 0 0px;
}

.iconModal {
    width: 70% !important;
    opacity: 0;
}

.dropzones.underline:hover .removeDrag {
    opacity: 1;
}

/**Reports**/
.reports .form-inline .form-control {
    width: 100% !important;
    display: block;
}

.autocomplete-suggestions {
    border: 1px solid #999;
    background: #FFF;
    overflow: auto;
}

.autocomplete-suggestion {
    padding: 2px 5px;
    white-space: nowrap;
    overflow: hidden;
}

.autocomplete-selected {
    background: #F0F0F0;
}

.autocomplete-suggestions strong {
    font-weight: normal;
    color: #3399FF;
}

.autocomplete-group {
    padding: 2px 5px;
}

    .autocomplete-group strong {
        display: block;
        border-bottom: 1px solid #000;
    }


/* START: Changes in Notifications Style - Miguel - 01/24/2018*/
.ui-pnotify .notification .ui-pnotify-text {
    font-size: 13px;
    line-height: 1.3em;
}

.ui-pnotify .notification .ui-pnotify-title {
    font-size: 14px;
    letter-spacing: 0;
    font-weight: bold;
}

.ui-pnotify .notification .ui-pnotify-icon > span {
    border: 2px solid #FFF;
    border-radius: 50%;
    display: inline-block;
    float: none;
    font-size: 20px;
    height: 30px;
    line-height: 29px !important;
    margin: 16px 0 0;
    padding: 0;
    width: 30px;
    text-align: center;
}
/* END: Changes in Notifications Style - Miguel - 01/24/2018*/
.panel-sectionGkan {
    background: #005A85 !important;
}

.notelement {
    border: 1px solid #d2322d !important;
    border-radius: 5px;
}

.Mwidth700 {
    max-width: 700px !important;
}


/*START TOUR STYLES*/
.wcp-tour-title, .wcp-tour-step-title {
    font-size: 38px;
    font-weight: 300;
    text-align: center;
    margin-bottom: 20px;
}
/*=======*/
.alert-success-link {
    color: #2b542c;
}

.alert-danger-link {
    color: #843534;
}


/*desde aqui copio*/

/*
* field
*/

/* reset */


.grabbableSQ {
    cursor: all-scroll; /* fallback if grab cursor is unsupported */
}

.showme {
    display: none;
}

.showhim:hover .showme {
    display: block;
}

.not-active {
    pointer-events: none;
    cursor: default;
    color: #555555 !important;
}

/*foco de los surveys*/
.ulcontenedor {
    height: auto;
    padding: 10px;
    margin: 0 auto;
}
    /*obliga a contenedor al tomar la altura de su contenido*/
    .ulcontenedor:before,
    .ulcontenedor:after {
        content: "";
        display: block;
        clear: both;
    }

li.itemsurvey {
    padding: 5px;
    background: #FFF;
    margin: 0 5px 5px 0;
    /*box-shadow: 1px 1px 10px rgba(0,0,0,0.4);*/
    -webkit-transition: box-shadow 1s, -webkit-transform 100ms, -webkit-filter 100ms ease-in-out;
    transition: box-shadow 1s, transform 100ms, filter 100ms ease-in-out;
}

    li.itemsurvey:hover {
        /*-webkit-transform: scale(1.0);
    transform: scale(1.0);
    box-shadow: 3px 3px 10px rgba(0,0,0,0.6);*/
    }

    li.itemsurvey h6 {
        font-size: 16px;
        font-weight: 400;
    }

    li.itemsurvey p {
        font-size: 11px;
    }

    li.itemsurvey a,
    li.itemsurvey a:link,
    li.itemsurvey a:visited {
        text-decoration: none;
        color: #000;
    }

li.blur {
    /*-webkit-filter: blur(3px);*/
    /*filter: blur(3px);*/
    /*-webkit-transform: scale(0.95);
    transform: scale(0.95);*/
}

.headersurvey {
    position: absolute !important;
    /*padding-bottom: 110px !important;*/
    z-index: 1 !important;
    border-bottom: none !important;
}

.p-md-nof-nol:first-child {
    padding-top: 0 !important;
}

.p-md-nof-nol:last-child {
    padding-bottom: 0 !important;
}

.none-border-right {
    border-right: none !important;
}

    .none-border-right:last-child {
        border-right: 1px solid #ccc !important;
        /*border-right-color:  #ccc !important;*/
    }

.field-survey {
    --fieldBorderColor: #ccc !important;
}

.text-ccc {
    color: #ccc !important;
}

.pt-notfirst {
    padding-top: 10px !important;
}

.background-unset {
    background: unset !important;
    padding-top: 20px !important;
}

.border-all-1-cece {
    border: 1px solid #cecece !important;
}

.text-align-left {
    text-align: left !important;
}

/*input.ng-invalid.ng-dirty {
    border-color: red;
    color: red;
}*/
/*input.ng-valid.ng-dirty {
    border-color: green;
    color: green;
}*/

.max-width60 {
    max-width: 60% !important;
}

.max-width55 {
    max-width: 55% !important;
}

.max-width150p {
    max-width: 15px !important;
}

.form-group .radio-custom label {
    font-size: 13px;
}

.dt-more-container {
    text-align: center;
    margin: 2em 0;
}

.gotoIndex {
    display: block;
    margin-bottom: 10px;
    width: 100%;
    border: 1px solid transparent;
}

.longCompanyName {
    padding-right: 15px !important;
    display: inline-block;
}

.roundedButton {
    /*border: 1px solid transparent;*/
    border-radius: 100px;
    background: #ddd;
}

    h2.font-size18 {
        color: #33353F;
        font-size: 18px !important;
        margin: unset;
        padding: unset;
    }

.width97por {
    width: 97% !important;
}

.width3 {
    width: 3% !important;
}

.topvh0 {
    top: 0vh !important;
}

.topvh10 {
    top: 10vh !important;
}

.actionSurvey {
    right: 7px !important;
    top: 12px !important;
}

.actionSurveyQuestion {
    right: 8px !important;
    top: 8px !important;
}

.survey-body {
    padding-left: 4px !important;
}

.formatH4 h4 {
    padding: 4px 0 7px 0 !important;
    margin: 0 !important;
}


.table-responsive.grid {
    margin-right: -15px;
}

.datatable-container {
    overflow: hidden;
}

    /*.datatable-container .item {
        position: relative;
     
        float: left;
        width: 257.5px;
        margin: 0 10px 20px 0;
    }*/

.dragging {
    box-shadow: 1px 1px 10px rgba(0,0,0,1) !important;
    border-radius: 5px !important;
    filter: blur(.5px);
    cursor: move;
}

.dragover {
    box-shadow: 1px 1px 20px #005984 !important;
    border-radius: 5px !important;
    /*filter: blur(2px);*/
}

.disabledHref {
    pointer-events: none;
    cursor: default;
}

.placeholder-proctor input {
    width: 250px !important;
}


.pos-fl {
    float: left;
    padding-right: 20px;
}

.pos-cl {
    float: none;
}

.overflow-x-uniset-respondive {
    overflow-x: unset;
}

.max-width20 {
    max-width: 35px;
}

.actionAndId {
    width: 30px;
}

.usedHeight25 {
    height: 24px !important;
}

#hide-item-student-dashboard {
    display: none;
}


/*Sirve para pintar los iconos de azul en el dashboard del estudiante, Agregado por Miguel, 19/04/2018*/
html .featured-boxes-style-6 .featured-box.featured-box-primary .icon-featured {
    color: #0088cc;
}

/*Overlay para cursos*/
/*Overlay*/
.gk-div-overlay,
.gk-overlay {
    -ms-transition: 1s all;
    -o-transition: 1s all;
    -webkit-transition: 1s all;
    -ms-transition: 1s all;
    -o-transition: 1s all;
    -webkit-transition: 1s all;
    transition: 1s all;
    border-radius: 3px;
}

.gk-div-overlay {
    width: 100%;
    margin-bottom: 115%; /*margin-bottom: -4px;*/
}

    .gk-div-overlay:hover {
        -webkit-filter: blur(2px);
        -moz-filter: blur(2px);
        filter: blur(2px);
    }

.gk-overlay {
    position: absolute;
    top: 0;
    left: 0;
    bottom: 0;
    width: 100%;
    background: rgba(0, 0, 0, 0.6);
    color: #fff;
    opacity: 0;
}

    .gk-overlay:hover {
        opacity: 1;
    }



    .gk-overlay h2 {
        text-align: center;
        padding: 6px 12px;
        border-radius: 25px;
        font-size: 2rem;
        margin: 3em auto;
        width: 150px;
    }



/*Charts*/
#flotBasic-title {
    float: right;
    font-size: 17px;
}

     .legendLabel {
        padding-right: 15px;
        padding-left: 5px;
    }

.va-top {
    vertical-align: top;
}

/*.showtitlecoure > * .text-truncate, .thumbnail small.text-muted {
    overflow: inherit !important;
    text-overflow: ellipsis;
    white-space: normal;
    -webkit-line-clamp: 1;
    -webkit-box-orient: vertical;
    display: block !important;
    padding-bottom: 0 !important;
}*/


.modal-text {
    padding: 0 15px;
    margin-top: 20px;
}

.modal-wrapper.awards .owl-carousel .owl-stage {
    margin: 0 auto !important;
}

/*Override class */
.flotTip {
    padding: 3px 5px;
    background-color: #000;
    z-index: 100;
    color: #fff;
    opacity: .7;
    filter: alpha(opacity=70);
    -webkit-border-radius: 4px;
    -moz-border-radius: 4px;
    border-radius: 4px;
}

/*ul.nav-main li .nav-children li a {
    padding: 6px 15px 6px 50px;
}

ul.nav-main li .nav-children {
    padding: 10px 10px 10px 0;
}*/


.label.summernote-label {
    position: relative;
    margin-right: 0.9em;
    font-size: 1.1rem !important;
}

.label.summernote-label > .badge {
    background: #D2312D;
    color: #FFF;
    font-size: 10px;
    font-weight: normal;
    height: 16px;
    padding: 3px 5px 3px 5px;
    position: absolute;
    right: -8px;
    top: -3px;
    border-radius: 100%;
}

html.sidebar-left-sm .sidebar-left ul.nav-main li a {
    font-size: 1.3rem;
}
/*Mover elementos del menu a la izquierda*/
.menu-item {
    margin-left: 20px;
}

.ext-questions {
    position: relative;
    background-color: #47a447;
    padding: 0 5px;
    color: #fff;
    border-radius: 5px;
    font-size: 1.5rem;
}

    .ext-questions p {
        color: white;
        font-size: 1.2em;
        margin: 0;
    }


@media (min-width: 768px) and (max-width: 991px) {
    html:not(.sidebar-left-collapsed) .call-to-action.courses .col-sm-8 {
        width: 66.66666667%;
    }

    html:not(.sidebar-left-collapsed) .call-to-action.courses .col-sm-4  {
        width: 33.33333333%;
    }

    
}

@media (max-width: 1199px) and (min-width: 768px) {
    html:not(.sidebar-left-collapsed) .call-to-action.courses .call-to-action-btn {
        margin-top: 10px !important;
    }
}


@media (max-width: 767px) {
    html:not(.sidebar-left-collapsed) .call-to-action.courses .call-to-action-btn {
        margin-top: 10px !important;
    }
}

/*Esta clase es para que las opciones de los charts lo ponga a un costado del titulo, Miguel*/
#flotBasicCourses-title {
    float: right;
    font-size: 17px;
}

/*Esta clase es para que el texto de los charts se vea de color negro, Miguel*/
.legendLabel {
    color: black;
}
#flotTip {
    padding: 3px 5px;
    background-color: #000;
    z-index: 100;
    color: #fff;
    opacity: .80;
    filter: alpha(opacity=85);
}

.padding-dashboard {
    padding-bottom: 6px !important;
}


.modal-block-info .fa {
    color: #777;
}



.jstree-default .jstree-checkbox {
    background-image: url(/Content/tools/jstree/themes/jstree.png) !important;
}


.tree-textAuto.jstree-default a { 
    white-space:normal !important; height: auto; 
    margin-right: 4px;
}
.tree-textAuto.jstree-anchor {
    height: auto !important;
}
.tree-textAuto.jstree-default li > ins { 
    vertical-align:top; 
}
.tree-textAuto.jstree-leaf {
    height: auto;
}
.tree-textAuto.jstree-leaf a{
    height: auto !important;
}


.border-button-none {
    border-bottom: none;
}

.tableFixHead { overflow-y: auto; height: 180px; }

.height238-p {
    height: 238px !important;
}
.height248-p {
    height: 248px !important;
}

.min-height-530-p {
    min-height: 530px !important;
}

/**==============Clases para botones redondeados=================*/
.btn-round-lg{
    border-radius: 22.5px;
}

.btn-round-sm{
    border-radius: 15px;
}
.btn-round-xs{
    border-radius: 11px;
    padding-left: 10px;
    padding-right: 10px;
}

/**==============TERMINA: Clases para botones redondeados=================*/

/**==============Clases alto de titulo de los tests=================*/
.h-100-px {
    height: 90px;
}

.header-texts {
    position: relative;
    /*padding: 18px;*/
}
.header-icons {
    font-size: 128px;
    top: 0;
    right: 0;
    color: #fff;
    width: 128px;
    /* height: 50px; */
    line-height: 35px;
    text-shadow: 3px 7px rgba(0,0,0,.25);
    position: absolute;
    opacity: .15;
    text-align: right;
    /* margin-left: 15px; */
}

    .header-icons i {
        position: relative;
        font-size: 65px;
       
    }
.fa-rotate-45 {
    -webkit-transform: rotate(45deg);
    -moz-transform: rotate(45deg);
    -ms-transform: rotate(45deg);
    -o-transform: rotate(45deg);
    transform: rotate(45deg);
}
.panel-overlay:hover .overlay {
    opacity: 1;
}

.panel-overlay.courses .panel-body,
.panel-overlay.awards .panel-body {
    position: relative;
}

a>section.panel.panel-overlay {
    overflow: hidden!important;
}


/**==============Clases alto de titulo de los tests=================*/

.table-hover > tbody  > tr:hover {
    background-color: rgba(0, 0, 0, 0.15);
}

/*Clase para alinear los checkboxes con el Spinner, Miguel*/
.margintop-33p {
    margin-top: 33px;
}
/*Clase para hacer mas pequeños los textboxes dentro de los DIVS*/
.w150px {
    width: 150px;
}

/*Alinear texto en el centro del input, Miguel*/
.align-inputtext-center {
    padding-left: 5px !important;
}

/*Txt Dates sizes, AccessCodes, Miguel*/
.txtw120px {
    width: 120px !important;
}






.width100px {
    width: 100px;
}

.width80px {
    width: 80px;
}

.spinner-InCode {
   
    line-height: 10px;
    height: 23px
}

.spinner-buttons-InCode {
    height: 23px;
}

.spinner-up-down {
    height: 12px!important;
}


.error-tooltip.error {
    border-color: #a94442;
}


/*Licenses Tabs*/
/*@media screen and (min-width: 1200px) {
    #tab-contenttree ul.nav {
        width: 180px !important;
    }
}

@media screen and (max-width: 992px) {
    #tab-contenttree ul.nav {
        width: 100% !important;
    }
}*/

/*Clase para posicionar el icono y texto al centro del DIV en Admin Dashboard, Miguel*/
.pt-80px {
    padding-top: 80px !important;
}

.mfp-figure:after, .mfp-iframe-scaler iframe {
    box-shadow: none !important;
}



/* Make clicks pass-through */
#loading-bar,
#loading-bar-spinner {
    pointer-events: none;
    -webkit-pointer-events: none;
    -webkit-transition: 350ms linear all;
    -moz-transition: 350ms linear all;
    -o-transition: 350ms linear all;
    transition: 350ms linear all;
}

    #loading-bar.ng-enter,
    #loading-bar.ng-leave.ng-leave-active,
    #loading-bar-spinner.ng-enter,
    #loading-bar-spinner.ng-leave.ng-leave-active {
        opacity: 0;
    }

        #loading-bar.ng-enter.ng-enter-active,
        #loading-bar.ng-leave,
        #loading-bar-spinner.ng-enter.ng-enter-active,
        #loading-bar-spinner.ng-leave {
            opacity: 1;
        }

    #loading-bar .bar {
        -webkit-transition: width 350ms;
        -moz-transition: width 350ms;
        -o-transition: width 350ms;
        transition: width 350ms;
        background: #29d;
        position: fixed;
        z-index: 10002;
        top: 0;
        left: 0;
        width: 100%;
        height: 2px;
        border-bottom-right-radius: 1px;
        border-top-right-radius: 1px;
    }

    /* Fancy blur effect */
    #loading-bar .peg {
        position: absolute;
        width: 70px;
        right: 0;
        top: 0;
        height: 2px;
        opacity: .45;
        -moz-box-shadow: #29d 1px 0 6px 1px;
        -ms-box-shadow: #29d 1px 0 6px 1px;
        -webkit-box-shadow: #29d 1px 0 6px 1px;
        box-shadow: #29d 1px 0 6px 1px;
        -moz-border-radius: 100%;
        -webkit-border-radius: 100%;
        border-radius: 100%;
    }

#loading-bar-spinner {
    display: block;
    position: fixed;
    z-index: 10002;
    top: 10px;
    left: 10px;
}

    #loading-bar-spinner .spinner-icon {
        width: 14px;
        height: 14px;
        border: solid 2px transparent;
        border-top-color: #29d;
        border-left-color: #29d;
        border-radius: 50%;
        -webkit-animation: loading-bar-spinner 400ms linear infinite;
        -moz-animation: loading-bar-spinner 400ms linear infinite;
        -ms-animation: loading-bar-spinner 400ms linear infinite;
        -o-animation: loading-bar-spinner 400ms linear infinite;
        animation: loading-bar-spinner 400ms linear infinite;
    }

@-webkit-keyframes loading-bar-spinner {
    0% {
        -webkit-transform: rotate(0deg);
        transform: rotate(0deg);
    }

    100% {
        -webkit-transform: rotate(360deg);
        transform: rotate(360deg);
    }
}

@-moz-keyframes loading-bar-spinner {
    0% {
        -moz-transform: rotate(0deg);
        transform: rotate(0deg);
    }

    100% {
        -moz-transform: rotate(360deg);
        transform: rotate(360deg);
    }
}

@-o-keyframes loading-bar-spinner {
    0% {
        -o-transform: rotate(0deg);
        transform: rotate(0deg);
    }

    100% {
        -o-transform: rotate(360deg);
        transform: rotate(360deg);
    }
}

@-ms-keyframes loading-bar-spinner {
    0% {
        -ms-transform: rotate(0deg);
        transform: rotate(0deg);
    }

    100% {
        -ms-transform: rotate(360deg);
        transform: rotate(360deg);
    }
}

@keyframes loading-bar-spinner {
    0% {
        transform: rotate(0deg);
    }

    100% {
        transform: rotate(360deg);
    }
}

/* fucking css for alerts*/
.notification-menu {
    border: none;
    left: auto;
    margin: 10px 0 0 0;
    padding: 0;
}
@charset "UTF-8";
body.student-panel .userbox {
  margin: 3px 10px 0 0;
}

/* Layout Base - Header */
.header {
  border-top: 0px;
}
.header .logo {
  margin-top: 7px;
}
.header .logo img {
  max-height: 46px !important;
  width: auto !important;
}

:focus {
  outline: 0;
  /* or */
  outline: none;
  outline-offset: 0;
}

/* Layout Base - Content Body */
.content-body {
  transition: all 0.3s ease-in;
}

/*button spinner*/
.spinner-buttons.btn-group-vertical .btn-xsm {
  height: 14px;
  padding: 0 5px;
  padding-left: 5px;
  padding-right: 5px;
  text-align: center;
  width: 20px;
  line-height: 1;
}
.spinner-buttons.btn-group-vertical .btn-xsm:last-child {
  height: 14px;
}

/*Spinner Tasks*/
/*keyframes*/
@keyframes spinner {
  to {
    transform: rotate(360deg);
  }
}
@keyframes spinner-add {
  from {
    transform: scale(0);
  }
  to {
    transform: scale(1);
  }
}
@keyframes spinner-remove {
  to {
    transform: scale(0);
  }
}
.spinner-task-container {
  background: #fff;
  width: 60px;
  height: 49px;
  line-height: 47px;
  float: right;
  font-size: 15px;
  border-radius: 5px;
  position: relative;
  text-align: center;
}

.spinner-task, .spinner-task:before {
  width: 20px;
  height: 20px;
  box-sizing: border-box;
}
.spinner-task:before {
  content: "";
  display: block;
  border-radius: 50%;
  border: 2px solid #ccc;
  border-top-color: #333;
  animation: spinner 0.6s linear infinite;
}

.spinner-absolute {
  position: absolute;
  top: 50%;
  left: 50%;
  margin-top: -10px;
  margin-left: -10px;
}

/* Animations */
.spinner-add,
.spinner-remove {
  animation-fill-mode: both;
  animation-duration: 0.4s;
}

.spinner-add {
  animation-name: spinner-add;
}

.spinner-remove {
  animation-name: spinner-remove;
}

@keyframes color {
  0% {
    background-color: rgba(165, 165, 165, 0.1);
  }
  50% {
    background-color: rgba(165, 165, 165, 0.3);
  }
  100% {
    background-color: rgba(165, 165, 165, 0.1);
  }
}
.text-input__loading {
  /* border: 1px solid lightgrey;*/
  border-radius: 4px;
}
.text-input__loading--line {
  height: 32px;
  width: 100%;
  animation: color 1.5s infinite ease-in-out;
}

.spinner,
.spinner-small {
  height: 40px;
  width: 40px;
  position: absolute;
  top: 50%;
  left: 50%;
  margin: -20px 0 0 -20px;
  border: 2px solid rgba(0, 0, 0, 0.5);
  border-top: 2px solid #fff;
  border-radius: 100%;
}

.spinner-md {
  height: 80px;
  width: 80px;
}

.spinner-light-blue {
  border: 5px solid #0277bd;
  border-top-color: #0091ea;
  border-right-color: #81d4fa;
  border-bottom-color: #0277bd;
  animation: spinner 0.6s linear infinite;
}

#page-loader,
.page-loader,
#container-loader {
  top: 0;
  left: 0;
  bottom: 0;
  right: 0;
  background: #E6E8EC;
  z-index: 9999;
}
#page-loader.fade,
.page-loader.fade,
#container-loader.fade {
  display: none;
}
#page-loader.fade.in, #page-loader.fade.show,
.page-loader.fade.in,
.page-loader.fade.show,
#container-loader.fade.in,
#container-loader.fade.show {
  display: block;
}

#page-loader,
.page-loader {
  position: fixed;
}

#container-loader {
  position: absolute;
  opacity: 0.5;
  background: transparent;
}

.element-blur {
  filter: blur(2px);
}

.element-opacity {
  background-color: rgba(0, 0, 0, 0.18);
  filter: opacity(30%);
}

.fade.in .spinner,
.fade.in .spinner-small {
  animation: rotation 0.6s infinite linear;
}

@keyframes rotation {
  from {
    transform: rotate(0);
  }
  to {
    transform: rotate(359deg);
  }
}
.spinner-small {
  border: 2px solid rgba(0, 0, 0, 0.05);
  border-top: 2px solid #24B498;
  height: 30px;
  width: 30px;
  margin: -15px 0 0 -15px;
}

@media only screen and (max-width: 767px) {
  .style-switcher-open {
    display: none !important;
  }
  .panel .panel-title {
    margin-right: 50px;
  }
  .inner-wrapper {
    padding-top: 130px;
  }
  .header .logo-container {
    border-top: 0;
  }
  .header .logo-container .toggle-sidebar-left {
    top: 74px;
    cursor: pointer;
  }
  .header .header-right {
    position: fixed;
    z-index: 98;
  }
  .header .header-right .userbox {
    margin: 16px 0 0 12px;
  }
  .header .header-right .userbox .name {
    max-width: 100%;
  }
  /* Layout Mobile - Sidebar Left Opened */
  html.sidebar-left-opened.no-csstransforms .sidebar-left {
    left: 0;
  }
  html.sidebar-left-opened.csstransforms .sidebar-left .sidebar-title {
    border-top-left-radius: 0 !important;
    border-top-right-radius: 0 !important;
  }
}
.lh-unset {
  line-height: unset !important;
}

.show-fulltext {
  height: 25px !important;
  position: relative;
}
.show-fulltext .full-text {
  position: absolute;
  top: 0px;
  left: 0px;
  visibility: hidden;
}

.show-fulltext:not(.not-show):hover {
  height: 27px !important;
}
.show-fulltext:not(.not-show):hover .full-text {
  visibility: visible;
  position: absolute;
  top: inherit;
  left: inherit;
  margin-left: -5px;
  padding-left: 5px;
  padding-right: 5px;
  background-color: white;
  border: solid 1px #b3b3b3;
  border-radius: 5px;
  box-shadow: 0 4px 8px 0 rgba(0, 0, 0, 0.4), 0 6px 20px 0 rgba(0, 0, 0, 0.39);
  z-index: 100;
}

.show-fulltext:not(.not-show):hover .line-clamp-line-two {
  position: absolute;
  visibility: hidden;
}

/*---------------------------------------*/
/* colores para test*/
.bg-primary_test {
  background: #FFF !important;
  color: #00a0de !important;
}

.bg-primary_test_inv {
  background: #00a0de !important;
  color: #FFF !important;
}

.bg_test {
  background: #00a0de !important;
  Color: #00a0de !important;
  border: none !important;
}

html body .tabs.tabs-bottom .nav-tabs li a.color-tests:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-tests,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-tests:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-tests:focus {
  border-bottom-color: #00a0de !important;
}

.color-tests {
  color: #00a0de !important;
}

.bg_test_level2 {
  background: #00a0de !important;
  Color: #FFF !important;
}

.bg_test_level3 {
  background: #00a0de !important;
  Color: #FFF !important;
}

.bg_test_assigned {
  background: #00a0de !important;
  Color: #00a0de !important;
}

.bg_test_saved {
  background: #00a0de !important;
  Color: #00a0de !important;
}

.bg_test_completed {
  background: #00a0de !important;
  Color: #00a0de !important;
}

.bg-primary_course {
  background: #FFF !important;
  color: #5d398a !important;
}

.bg-primary_course_inv {
  background: #5d398a !important;
  color: #FFF !important;
}

.bg_course {
  background: #5d398a !important;
  Color: #5d398a !important;
  border: none !important;
}

html body .tabs.tabs-bottom .nav-tabs li a.color-courses:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-courses,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-courses:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-courses:focus {
  border-bottom-color: #5d398a !important;
}

.color-courses {
  color: #5d398a !important;
}

.bg_course_level2 {
  background: #5d398a !important;
  Color: #5d398a !important;
}

.bg_course_level3 {
  background: #5d398a !important;
  Color: #5d398a !important;
}

.bg_course_assigned {
  background: #5d398a !important;
  Color: #5d398a !important;
}

.bg_course_saved {
  background: #5d398a !important;
  Color: #5d398a !important;
}

.bg_course_completed {
  background: #5d398a !important;
  Color: #5d398a !important;
}

.bg-primary_survey {
  background: #FFF !important;
  color: #5c8825 !important;
}

.bg-primary_survey_inv {
  background: #5c8825 !important;
  color: #FFF !important;
}

.bg_survey {
  background: #5c8825 !important;
  Color: #5c8825 !important;
  border: none !important;
}

html body .tabs.tabs-bottom .nav-tabs li a.color-surveys:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-surveys,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-surveys:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-surveys:focus {
  border-bottom-color: #5c8825 !important;
}

.color-surveys {
  color: #5c8825 !important;
}

.bg_survey_level2 {
  background: #5c8825 !important;
  Color: #5c8825 !important;
}

.bg_survey_level3 {
  background: #5c8825 !important;
  Color: #5c8825 !important;
}

.bg_survey_assigned {
  background: #5c8825 !important;
  Color: #5c8825 !important;
}

.bg_survey_saved {
  background: #5c8825 !important;
  Color: #5c8825 !important;
}

.bg_survey_completed {
  background: #5c8825 !important;
  Color: #5c8825 !important;
}

.bg-primary_Student {
  background: #FFF !important;
  color: #fe9816 !important;
}

.bg-primary_Student_inv {
  background: #fe9816 !important;
  color: #FFF !important;
}

.bg_Student {
  background: #fe9816 !important;
  Color: #fe9816 !important;
  border: none !important;
}

.bg_Student_level2 {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Student_level3 {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Student_assigned {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Student_saved {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Student_completed {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg-primary_Question {
  background: #FFF !important;
  color: #fe9816 !important;
}

.bg-primary_Question_inv {
  background: #fe9816 !important;
  color: #FFF !important;
}

.bg_Question {
  background: #fe9816 !important;
  Color: #fe9816 !important;
  border: none !important;
}

.bg_Question_level2 {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Question_level3 {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Question_assigned {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Question_saved {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_Question_completed {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg-primary_awards {
  background: #FFF !important;
  color: #fe9816 !important;
}

.bg-primary_awards_inv {
  background: #fe9816 !important;
  color: #FFF !important;
}

.bg_awards {
  background: #fe9816 !important;
  Color: #fe9816 !important;
  border: none !important;
}

html body .tabs.tabs-bottom .nav-tabs li a.color-awards:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-awards,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-awards:hover,
html body .tabs.tabs-bottom .nav-tabs li.active a.color-awards:focus {
  border-bottom-color: #fe9816 !important;
}

.color-awards {
  color: #fe9816 !important;
}

.bg_awards_level2 {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_awards_level3 {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_awards_assigned {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_awards_saved {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg_awards_completed {
  background: #fe9816 !important;
  Color: #fe9816 !important;
}

.bg-primary_class {
  background: #FFF;
  color: #8700B2;
}

.bg_class {
  background: #8700B2;
  border: none !important;
}

.bg-primary_class_inv {
  background: #8700B2;
  color: #FFF;
}

.bg-primary_awards {
  background: #FE9816;
  color: #fe9816;
}

.bg_awards {
  background: #fe9816;
  border: none !important;
}

.bg-primary_awards_inv {
  background: #fe9816;
  color: #FE9816;
}

.abp-dropzone {
  width: 100%;
  height: 170px;
  padding: 1rem 2rem;
  text-align: center;
  border: dashed 1px #979797;
  position: relative;
  margin: 0 auto;
  margin-bottom: 20px;
  display: flex;
  align-items: center;
  flex-wrap: wrap;
  align-content: center;
}
.abp-dropzone input {
  opacity: 0;
  position: absolute;
  z-index: 2;
  width: 100%;
  height: 100%;
  top: 0;
  left: 0;
}
.abp-dropzone h3, .abp-dropzone .caption {
  margin-top: 4px;
  margin-bottom: 2px;
  font-size: 13px;
  color: #1567ce;
  font-weight: unset;
}
.abp-dropzone .items {
  width: 100%;
}
.abp-dropzone .abp-container-image {
  height: 100px;
  width: 100%;
  display: flex;
  justify-content: center;
  margin-bottom: 5px;
}
.abp-dropzone .abp-container-image img {
  /*float: left;*/
  max-height: 100% !important;
}

@media (min-width: 1397px) {
  .abp-dropzone {
    height: 190px;
  }
  .abp-dropzone h3, .abp-dropzone .caption {
    font-size: 12px;
  }
}
@media (min-width: 1000px) {
  .abp-dropzone {
    height: 200px;
  }
  .abp-dropzone h3, .abp-dropzone .caption {
    font-size: 12px;
  }
}
/*
* ABP UPLOAD SCENARIO
*/
.abp-dropzone-scenario {
  max-width: 450px;
  max-height: 370px;
  min-width: 350px;
  min-height: 220px;
  padding: 1rem 2rem;
  text-align: center;
  border: 3px dashed #e1e2e3;
  position: relative;
  margin: 0 auto;
  margin-bottom: 50px;
}
.abp-dropzone-scenario .bottom-50 {
  top: 50% !important;
}
.abp-dropzone-scenario .bottom-0 {
  bottom: 0% !important;
}
.abp-dropzone-scenario .margin-bottom-50 {
  margin-bottom: 50px;
}
.abp-dropzone-scenario p:not(.error), .abp-dropzone-scenario .caption {
  margin: 0;
  color: #1567ce;
  font-size: 16px;
  position: absolute;
  left: 50%;
  margin-right: -50%;
  transform: translate(-50%, -50%);
}
.abp-dropzone-scenario input {
  opacity: 0;
  position: absolute;
  z-index: 2;
  width: 100%;
  height: 100%;
  top: 0;
  left: 0;
}
.abp-dropzone-scenario label.error {
  color: red;
  text-align: center;
  margin-bottom: 0;
  padding-bottom: 0;
  line-height: 1em;
  font-weight: bold;
}
.abp-dropzone-scenario .has-file {
  position: absolute;
  bottom: -25px;
  width: 100%;
  text-align: center;
  left: 0px;
}
.abp-dropzone-scenario .text {
  position: absolute;
  z-index: 999;
  margin: 0 auto;
  left: 0;
  right: 0;
  text-align: center;
  top: 0%;
  font-size: 12px;
  color: red;
  width: 100%;
}

.img-question-scenario {
  align-items: center;
  justify-content: center;
  display: block;
  width: 350px !important;
  height: 220px !important;
  height: auto;
  margin: auto;
}

/*Impersonation*/
body.body-impersonation .header-impersonate {
  height: 60px;
  z-index: 1021;
  background: #F8C657 !important;
  margin-bottom: 60px;
  display: flex;
  flex-direction: row;
  justify-content: space-between;
}
body.body-impersonation .header-impersonate .header-item {
  padding: 20px;
  font-size: 12px;
  font-weight: 600;
  color: #000;
}
body.body-impersonation .header-impersonate .header-item.exit-container a,
body.body-impersonation .header-impersonate .header-item.exit-container a:visited,
body.body-impersonation .header-impersonate .header-item.exit-container a:focus-visible {
  color: #000 !important;
}
body.body-impersonation .header-blue,
body.body-impersonation .companies-header {
  top: 60px;
}
body.body-impersonation .inner-wrapper {
  padding-top: 145px !important;
}
body.body-impersonation .sidebar-left {
  top: 120px;
}

span.badge {
  background: transparent;
  color: #000;
  font-size: 11px;
  font-weight: normal;
  height: 14px;
  padding: 3px 5px 3px 5px;
  position: absolute;
  right: -11px;
  top: -8px;
  border-radius: 100%;
}

html.sidebar-left-collapsed .left-menu-teams .nano .nav-main li a span {
  visibility: visible !important;
}

.left-menu-teams .nano .nav-main li span {
  color: white !important;
  display: flex !important;
  flex-flow: column nowrap !important;
  align-items: center !important;
  width: 70px;
}

.label-purple {
  background-color: mediumpurple;
}

.br-none {
  border-radius: 0 !important;
}

.bs-none {
  box-shadow: none !important;
}

.text-xxlg {
  font-size: 2.8rem;
}

.custom-box {
  box-shadow: none;
}

.p-xs-7 {
  padding: 7px !important;
}

.pb-35 {
  padding-bottom: 35px !important;
}

.mb-35 {
  margin-bottom: 35px !important;
}

.d-inline-block {
  display: inline-bock !important;
}

.w100p {
  width: 100% !important;
}

.h100p {
  height: 100%;
}

.h100vh {
  height: 100vh;
}

.text-dark {
  color: #000 !important;
}

.text-dark-bold {
  color: #000 !important;
  font-weight: 550;
}

.text-white {
  color: #FFF !important;
}

[aria-expanded=false] > .expanded,
[aria-expanded=true] > .collapsed {
  display: none;
}

.min-height-200-p {
  min-height: 200px !important;
}

.min-height-auto {
  min-height: auto !important;
}

.not-spin-button input[type=number] {
  -moz-appearance: textfield;
}
.not-spin-button input::-webkit-outer-spin-button,
.not-spin-button input::-webkit-inner-spin-button {
  -webkit-appearance: none;
}

.vertical-align {
  display: table-cell;
  vertical-align: middle !important;
}

.row-custom {
  margin-left: -10px;
  margin-right: -15px;
}
.row-custom a {
  text-decoration: none !important;
}

[ng-click],
[data-ng-click],
[x-ng-click] {
  cursor: pointer;
}

.mr-10 {
  margin-right: 10px !important;
}

.mt-xs-minus {
  margin-top: -5px !important;
}

.ellip {
  display: block;
  height: 100%;
}

.ellip-line {
  display: inline-block;
  text-overflow: ellipsis;
  white-space: nowrap;
  word-wrap: normal;
  max-width: 100%;
}

.ellip,
.ellip-line {
  position: relative;
  overflow: hidden;
}

.text-clamp {
  overflow: hidden;
}
.text-clamp.text-clamp {
  display: -webkit-box !important;
  -webkit-line-clamp: 1;
  -webkit-box-orient: vertical;
  line-height: initial;
  text-overflow: ellipsis;
}
.text-clamp.text-clamp.inline-box {
  display: -webkit-inline-box !important;
}
@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  .text-clamp.text-clamp.inline-box {
    display: inline-block !important;
    margin-top: 15px;
  }
}
.text-clamp.text-clamp.line-clamp-two {
  -webkit-line-clamp: 2;
  height: 5.07rem !important;
}
.text-clamp.text-clamp.line-clamp-three {
  -webkit-line-clamp: 3;
}
.text-clamp.text-clamp p {
  margin: 0;
}
.text-clamp.title {
  max-width: 300px;
  line-height: 25px;
}
.text-clamp.title.name {
  min-height: 49px;
}
.text-clamp.titleTest {
  max-width: 70% !important;
  line-height: 25px;
}
@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  .text-clamp.text-clamp {
    display: block !important;
    text-overflow: ellipsis;
    white-space: nowrap;
    line-height: normal !important;
  }
}

.mfp-custom-popup {
  position: relative;
  background: #FFF;
  padding: 20px;
  width: auto;
  max-width: 500px;
  margin: 20px auto;
}
.mfp-custom-popup audio {
  width: 90%;
  margin: 5px auto;
  display: block;
}
.mfp-custom-popup .mfp-close {
  color: #000000 !important;
  font-size: 25px;
}

.custom-spinner-loading {
  height: 100%;
  /*******************\
      Loading Roller
  \*******************/
}
.custom-spinner-loading .spinner {
  display: contents;
  flex-direction: column;
  align-items: center;
  justify-content: center;
  height: 100vh;
  width: 100vw;
}
.custom-spinner-loading .spinner {
  display: ruby-base !important;
  flex-direction: column;
  align-items: center;
  justify-content: center;
  height: 100vh;
  width: 100vw;
}
@keyframes lds-roller {
  0% {
    transform: rotate(0deg);
  }
  100% {
    transform: rotate(360deg);
  }
}
.custom-spinner-loading .lds-roller {
  position: relative;
  display: inline-block;
  height: 64px;
  width: 64px;
}
.custom-spinner-loading .lds-roller div {
  animation: lds-roller 1.2s cubic-bezier(0.5, 0, 0.5, 1) infinite;
  transform-origin: 32px 32px;
}
.custom-spinner-loading .lds-roller div:after {
  position: absolute;
  display: block;
  background: #00539f;
  border-radius: 50%;
  content: " ";
  margin: -3px 0 0 -3px;
  height: 6px;
  width: 6px;
}
.custom-spinner-loading .lds-roller div:nth-child(1) {
  animation-delay: -0.036s;
}
.custom-spinner-loading .lds-roller div:nth-child(1):after {
  top: 50px;
  left: 50px;
}
.custom-spinner-loading .lds-roller div:nth-child(2) {
  animation-delay: -0.072s;
}
.custom-spinner-loading .lds-roller div:nth-child(2):after {
  top: 54px;
  left: 45px;
}
.custom-spinner-loading .lds-roller div:nth-child(3) {
  animation-delay: -0.108s;
}
.custom-spinner-loading .lds-roller div:nth-child(3):after {
  top: 57px;
  left: 39px;
}
.custom-spinner-loading .lds-roller div:nth-child(4) {
  animation-delay: -0.144s;
}
.custom-spinner-loading .lds-roller div:nth-child(4):after {
  top: 58px;
  left: 32px;
}
.custom-spinner-loading .lds-roller div:nth-child(5) {
  animation-delay: -0.18s;
}
.custom-spinner-loading .lds-roller div:nth-child(5):after {
  top: 57px;
  left: 25px;
}
.custom-spinner-loading .lds-roller div:nth-child(6) {
  animation-delay: -0.216s;
}
.custom-spinner-loading .lds-roller div:nth-child(6):after {
  top: 54px;
  left: 19px;
}
.custom-spinner-loading .lds-roller div:nth-child(7) {
  animation-delay: -0.252s;
}
.custom-spinner-loading .lds-roller div:nth-child(7):after {
  top: 50px;
  left: 14px;
}
.custom-spinner-loading .lds-roller div:nth-child(8) {
  animation-delay: -0.288s;
}
.custom-spinner-loading .lds-roller div:nth-child(8):after {
  top: 45px;
  left: 10px;
}

.disabled-link i.fa-user-circle {
  color: #fff !important;
}

.background-white {
  background-color: white;
}

.no-underline {
  text-decoration: none !important;
}

/*******************\
    angularjs button spinner
\*******************/
@keyframes spin-btn {
  from {
    transform: scale(1) rotate(0deg);
  }
  to {
    transform: scale(1) rotate(360deg);
  }
}
.btn-submit .far.fa-spinner,
.btn-submit .fal.fa-spinner,
.btn-submit .fad.fa-spinner,
.btn-submit .fa.fa-spinner {
  animation: spin-btn 1s infinite linear;
  -webkit-animation: key-spin-btn 1s infinite linear;
}

.tooltip-wrapper {
  display: inline-block; /* display: block works as well */
}
.tooltip-wrapper.disabled {
  /* OPTIONAL pointer-events setting above blocks cursor setting, so set it here */
  cursor: not-allowed;
}
.tooltip-wrapper.disabled a {
  color: #666;
}
.tooltip-wrapper.disabled a.disabled {
  pointer-events: none;
}

.btn.btn-noStyle {
  background: none;
  color: inherit;
  border: none;
  padding: 0;
  font: inherit;
  cursor: pointer;
  outline: inherit;
}

.input-date-picker {
  width: 100%;
}

.action-manage-licensing-content {
  width: 50px;
}

.block-all-settings {
  width: 100%;
  display: flex;
  flex-direction: row;
  align-items: center;
}
.block-all-settings .item-settings {
  display: flex;
  margin-right: 10px;
}

.content-loked-license {
  width: 70px;
}

.license-contents-headers thead tr th {
  height: 53px;
}
.license-contents-headers tbody tr td {
  height: 42px;
}

label.error {
  display: block !important;
}
label.error.hidden {
  display: none !important;
}

.w-600 {
  width: 600px !important;
}

.w-0-percentage {
  width: 0% !important;
}

.word-wrap-custom {
  word-wrap: break-word !important;
}

.display-none {
  display: none !important;
}

.w-200 {
  width: 200px !important;
}

.display-inline-block {
  display: inline-block !important;
}

.calendar-range-filter {
  z-index: 9999999999 !important;
}

.wrapper-custom-search-input #searchclear {
  position: absolute;
  right: 50px;
  top: 0;
  bottom: 7px;
  height: 14px;
  margin: auto;
  font-size: 20px;
  cursor: pointer;
  color: #ccc;
  z-index: 100000;
}
.wrapper-custom-search-input .add-padding {
  padding-right: 40px;
}

.display-block {
  display: block !important;
}

.text-left {
  text-align: left !important;
}

label.display-block.text-left.text-danger {
  font-size: 0.9em;
}

.width-600 {
  width: 600px !important;
}

.body-expired {
  max-width: none;
  min-height: 400px;
  padding-bottom: 30px;
}

.force-expired {
  background: transparent !important;
  border-top: none !important;
  border-radius: 0px !important;
  box-shadow: none !important;
}

html .panel-sign .force-expired.panel-body:not(.success) {
  border-top: none !important;
}

.h-12px {
  height: 12px !important;
}

.play-button {
  position: absolute;
  top: 20%;
  left: 42%;
  font-size: 38px;
}

.mb-45 {
  margin-bottom: 45px;
}

.btn-take-course-cim {
  width: 75px;
  height: 75px;
  border-radius: 50%;
  display: flex;
  justify-content: center;
  align-items: center;
  cursor: pointer;
  border: none;
  outline: none;
}
.btn-take-course-cim i {
  font-size: 38px;
  margin-left: 8px;
}

.progres-bar-cim {
  width: 100%;
  display: flex;
  flex-wrap: nowrap;
  padding-right: 5px;
}
.progres-bar-cim .header-course-progress-container {
  width: inherit;
}

.mb-45 {
  margin-bottom: 45px;
}

.fs-2-4-rem {
  font-size: 2.4rem !important;
}

.fs-2-rem {
  font-size: 2rem !important;
}

.fs-1-6-rem {
  font-size: 1.6rem !important;
}

.show-always {
  z-index: 3;
}

.panel-top-position {
  margin-top: 100px !important;
}

label.locked {
  color: red !important;
}

.color-black {
  color: black !important;
}

.fs-40px {
  font-size: 40px;
}

div.pin-container {
  display: inline-block;
  position: relative;
}

input.input-number {
  height: 34px !important;
  padding: 6px 9px !important;
  font-size: 18px !important;
  line-height: 1.42857143 !important;
  color: #555 !important;
  background-color: #fff !important;
  background-image: none !important;
  border: 1px solid #ccc !important;
  width: 34px;
}

div.pin-container:nth-child(1) input {
  border-radius: 4px 0 0 4px !important;
}

div.pin-container:last-child input {
  border-radius: 0 4px 4px 0 !important;
}

.z-index-link {
  z-index: 10;
  position: relative;
}

.user-profile-information span::after {
  content: " | ";
}
.user-profile-information span:last-child::after {
  content: "";
}

.profile-date-of-birth {
  display: flex;
  flex-wrap: nowrap;
  justify-content: flex-start;
}
.profile-date-of-birth select {
  max-width: 150px;
}

.test-settings-input {
  width: 60px !important;
  display: inline-block;
}

.mt-150 {
  margin-top: 150px !important;
}

.fs-14 {
  font-size: 14px !important;
}

.disable-link {
  color: black;
  cursor: not-allowed;
  pointer-events: none;
  text-decoration: none;
}

.modal-custom-lg .modal-dialog {
  width: 90%;
  height: 90%;
  margin: auto;
}

.modal-custom-lg .modal-content {
  width: 90%;
  margin: auto;
}

tr.duplicated {
  background: rgb(245, 245, 4) !important;
}

.zmoveover {
  z-index: 10 !important;
}

.text-wrap {
  word-break: break-word;
  overflow-wrap: break-word;
  white-space: normal;
}

.error-wall {
  width: 100%;
  height: 100%;
  position: fixed;
  text-align: center;
  transition: 0.3s all ease-in-out;
}
.error-wall.load-error h1,
.error-wall.load-error h4 {
  color: #f3785e;
}
.error-wall.matinence h1,
.error-wall.matinence h4 {
  color: #a473b1;
}
.error-wall.missing-page h1,
.error-wall.missing-page h4 {
  color: #00bbc6;
}
.error-wall .error-container {
  display: block;
  width: 100%;
  position: absolute;
  left: 50%;
  top: 40%;
  transform: translate(-50%, -50%);
}
.error-wall .error-container h1 {
  font-size: 80px;
  margin: 0;
}
@media (max-width: 850px) {
  .error-wall .error-container h1 {
    font-size: 65px;
  }
}
.error-wall .error-container h3 {
  color: #464444;
  font-size: 34px;
  margin: 0;
}
@media (max-width: 850px) {
  .error-wall .error-container h3 {
    font-size: 25px;
  }
}
.error-wall .error-container h4 {
  margin: 0;
  font-size: 40px;
}
@media (max-width: 850px) {
  .error-wall .error-container h4 {
    font-size: 35px;
  }
}
.error-wall .error-container p {
  font-size: 15px;
}
.error-wall .error-container p:first-of-type {
  color: #464444;
  font-weight: lighter;
}
.error-wall .error-container p:nth-of-type(2) {
  color: #464444;
  font-weight: bold;
}
.error-wall .error-container p.type-white {
  color: #fff;
}
@media (max-width: 850px) {
  .error-wall .error-container p {
    font-size: 12px;
  }
}
@media (max-width: 390px) {
  .error-wall .error-container p {
    font-size: 10px;
  }
}

/* Form - Custom Checkbox */
.checkbox-custom.checkbox-table {
  position: relative;
  display: table;
  margin-top: 12px;
}
.checkbox-custom input[type=checkbox]:disabled:checked + input[type=hidden] + label:after {
  color: #999;
}
.checkbox-custom input[type=checkbox]:disabled + input[type=hidden] + label {
  cursor: not-allowed;
}
.checkbox-custom input[type=checkbox]:disabled + input[type=hidden] + label:before {
  background-color: #eee;
}

/* Form - Input group select*/
.input-group.input-group-select {
  width: 100%;
}
.input-group.input-group-select .form-control:first-child {
  width: 70%;
  border-top-right-radius: 4px;
  border-bottom-right-radius: 4px;
}
.input-group.input-group-select .form-control:last-child {
  border-top-left-radius: 4px;
  border-bottom-left-radius: 4px;
  margin-left: 10px;
  width: 28%;
}
.input-group.input-group-questions {
  width: 100%;
}
.input-group.input-group-questions > :first-child {
  width: 30px;
  float: left;
  background: transparent;
  margin-top: 5px;
}
.input-group.input-group-questions > :last-child {
  width: 70px;
  text-align: center;
  background: transparent;
}
.input-group.input-group-questions > :last-child button {
  float: none !important;
  margin-top: 5px;
  border: none;
  box-shadow: none;
  background: transparent;
  padding: 0 5px !important;
}
.input-group.input-group-questions > :last-child button:active, .input-group.input-group-questions > :last-child button.active {
  box-shadow: none;
}
.input-group.input-group-questions > .form-control {
  border-radius: 4px !important;
  width: calc(100% - 100px);
}

@media (max-width: 320px) {
  .input-group.input-group-questions > :last-child {
    width: 25%;
  }
  .input-group.input-group-questions > .form-control {
    width: 75%;
  }
}
@media (max-width: 768px) {
  .input-group.input-group-select .form-control:first-child {
    width: 100%;
  }
  .input-group.input-group-select .form-control:last-child {
    margin-top: 10px;
    margin-left: 0;
    width: 100%;
  }
  .input-group.input-group-questions > :first-child {
    display: none;
  }
  .input-group.input-group-questions > :last-child {
    width: 15%;
  }
  .input-group.input-group-questions > .form-control {
    width: 85%;
  }
}
.select-icon.selected {
  font-family: "Font Awesome 5 Pro", "Helvetica";
}
.select-icon option.icon {
  font-family: "Font Awesome 5 Pro", "Helvetica";
}

.insertmultiples-email > .select2-container--default .select2-container--focus,
.insertmultiples-email > .select2-container--default .select2-selection--multiple {
  border: 1px solid #cecece !important;
  border-bottom-left-radius: 4px !important;
  border-bottom-right-radius: 4px !important;
}

.has-error .insertmultiples-email > .select2-container--default .select2-container--focus,
.has-error .insertmultiples-email > .select2-container--default .select2-selection--multiple {
  border-color: #a94442 !important;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075) !important;
}
.has-error .note-editor {
  border-color: #a94442 !important;
}

/*Dropdown menu */
.dropdown-menu .dropdown-item {
  display: block;
  width: 100%;
  clear: both;
  font-weight: 400;
  color: #212529;
  text-align: inherit;
  white-space: nowrap;
  background-color: transparent;
  border: 0;
}

/*Button link*/
.btn-link {
  text-decoration: none;
}
.btn-link.active, .btn-link:hover {
  text-decoration: underline;
}

.modalfixed {
  position: fixed !important;
}

.left-quit-100 {
  left: -100px !important;
}

.isDisabled-link {
  cursor: not-allowed;
  opacity: 0.5;
}

.isDisabled-link > a {
  color: currentColor;
  display: inline-block; /* For IE11/ MS Edge bug */
  pointer-events: none;
  text-decoration: none;
}

/*filtro search*/
.select2-container--bootstrap .select2-results > .select2-results__options {
  max-height: 250px;
  overflow-y: auto;
}

/*input super samll*/
.input-xsm {
  height: 27px;
  padding: 4px 8px;
  font-size: 13px;
  line-height: 1.2;
  border-radius: 3px;
  width: 70px;
}

/*form-inline*/
.form-inline {
  /*.radio-custom {
      &:last-child, &:last-of-type {
          margin-bottom: 7px !important;
      }
  }*/
}
.form-inline .spinner-inline {
  display: inline-block;
}
.form-inline.d-flex {
  display: flex;
}

/*For angular JS*/
/*Select2 -- ui-select */
/*Wrapper for theme porto*/
.ui-select-multiple.ui-select-bootstrap {
  padding: 4px 12px 5px 12px;
}
.ui-select-multiple input.ui-select-search {
  max-width: 100% !important;
  min-width: 100px !important;
  margin-bottom: 0 !important;
}

.butons-reset-custom-ui {
  position: relative;
  top: 28px;
}
.butons-reset-custom-ui a {
  cursor: pointer;
}

.preview-custom-logo img {
  max-height: 46px;
  max-width: 150px;
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.preview-custom-logo .btn-upload {
  max-width: 150px;
  display: block;
  margin-left: auto;
  margin-right: auto;
}

.fav-icone.logo {
  margin-top: 10px;
  margin-bottom: 10px;
  height: 44px;
}
.fav-icone.logo img {
  max-height: 25px !important;
}

.alert-notification {
  background-color: rgba(0, 0, 0, 0.7);
  border-color: #000;
  color: #ffffff;
}

.used-toggle label i {
  position: absolute;
  top: 40%;
  left: 5px;
}
.used-toggle label .unlimited {
  position: unset !important;
  top: 0 !important;
  left: 0 !important;
}
.used-toggle .toggle.active .course {
  background: #E36159 !important;
  border-color: #E36159;
  color: #ffffff;
}
.used-toggle .toggle.active .test {
  background: #00AADC !important;
  border-color: #00AADC;
  color: #ffffff;
}
.used-toggle .toggle.active .survey {
  background: #5CB85C !important;
  border-color: #5CB85C;
  color: #ffffff;
}
.used-toggle .toggle label.course {
  border-left-color: #E36159;
  color: #E36159;
}
.used-toggle .toggle label.test {
  border-left-color: #00AADC;
  color: #00AADC;
}
.used-toggle .toggle label.survey {
  border-left-color: #5CB85C;
  color: #5CB85C;
}
.used-toggle .toggle .max-height-450 {
  max-height: 450px;
  overflow-y: auto;
  display: block;
}

.info-licenses hr {
  margin: 10px 0 10px 0;
}

.strike-through {
  text-decoration: line-through;
}

.scrolling-tabs-wrapper > .scrollable-tabs {
  position: relative;
}
.scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs {
  overflow: hidden;
  white-space: nowrap;
  user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  -webkit-user-select: none;
}
.scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li {
  display: inline-block;
  float: none;
}
.scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li > a {
  border-bottom: 3px solid #fff !important;
  background-color: #fff;
}
.scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li.active > a {
  border-bottom: 3px solid #555 !important;
}
.scrolling-tabs-wrapper > .scrollable-tabs.scrollable:before, .scrolling-tabs-wrapper > .scrollable-tabs.scrollable:after {
  background: #fff;
  border: solid 1px #ccc;
  cursor: pointer;
  font-weight: bold;
  line-height: 38px;
  height: 41px;
  padding: 0 7px;
  position: absolute;
  z-index: 1;
}
.scrolling-tabs-wrapper > .scrollable-tabs.scrollable:before {
  content: "<";
  border-radius: 4px 0 0 0;
}
.scrolling-tabs-wrapper > .scrollable-tabs.scrollable:after {
  content: ">";
  right: 0;
  border-radius: 0 4px 0 0;
  top: 0;
}
.scrolling-tabs-wrapper > .scrollable-tabs.scrollable > ul.nav-tabs {
  padding-left: 22px;
}
.scrolling-tabs-wrapper > .scrollable-tabs.scrollable > ul.nav-tabs > li:last-child {
  margin-right: 20px;
}

.scrolling-tabs-bg-none > .scrollable-tabs > .nav-tabs > li > a {
  background: transparent !important;
}
.scrolling-tabs-bg-none > .scrollable-tabs > .tab-content {
  background: transparent !important;
}

.counterquestions {
  position: absolute;
  top: -5px;
  font-size: 12px;
  padding-left: 2px;
}

.container-img-choice {
  width: 100%;
  display: flex;
  padding: 15px 5px;
  /*.img-choice-prew {
      width: 170px;
      height: 100px;
      padding: 0 5px;

      .preview-answer {
          background: #cecece;
          width: 100%;
          height: 100%;
          position: relative;

          img {
              max-height: 100%;
              max-width: 100%;
              width: auto;
              height: auto;
              position: absolute;
              top: 0;
              bottom: 0;
              left: 0;
              right: 0;
              margin: auto;
          }
      }
  }*/
}
.container-img-choice .mark-answer {
  width: 25px;
}
.container-img-choice .mark-answer .radio-custom {
  margin: 0;
  position: absolute;
  top: 50%;
  transform: translateY(-50%);
}
.container-img-choice .img-options {
  width: calc(100% - 80px);
  padding-right: 5px;
  display: flex;
  flex-direction: row;
  align-items: center;
}
.container-img-choice .img-options .img-btn {
  margin-top: 10px;
  width: 160px;
}
.container-img-choice .img-options .abp-dropzone {
  margin-bottom: 5px;
  margin-right: 5px;
}
.container-img-choice .opts-answer {
  width: 55px;
}
.container-img-choice .opts-answer .container-Options {
  padding-left: 5px;
  margin: 0;
  position: absolute;
  top: 50%;
  transform: translateY(-50%);
}
.container-img-choice .opts-answer .container-Options .option-answer {
  font-size: 20px;
}

.gallery-audio, .videojs-simple {
  color: #000;
}
.gallery-audio .play-select, .videojs-simple .play-select {
  color: #000 !important;
}

.scenarios-options i {
  color: #000 !important;
}

.scenario-banck-options {
  width: 150px !important;
}

.manage-students-cog a.dropdown-toggle {
  cursor: pointer;
  color: gray;
  text-decoration: none;
}
.manage-students-cog a.dropdown-toggle:hover {
  color: gray !important;
}
.manage-students-cog ul {
  min-width: 40px;
  left: -155px;
}
.manage-students-cog ul li {
  font-size: 13px;
}

.plugin-remove_button .item .remove {
  border-left: none !important;
}

.skilli-downdown .select2-selection--multiple li:not(.select2-search--inline) {
  border: none !important;
  border-radius: unset !important;
}
.skilli-downdown .select2-selection--multiple .select2-selection__choice__remove {
  float: right;
  padding-left: 3px;
  margin-left: 3px;
}
.skilli-downdown .select2-selection--multiple .select2-selection__rendered li:not(.select2-search--inline) {
  cursor: pointer;
  margin: 5px 3px 3px 0;
  padding: 2px 6px;
  background: #f2f2f2;
  color: #303030;
  border: 0 solid #d0d0d0 !important;
}

.gradebook-filter .skilli-downdown .selection .select2-selection--single {
  min-height: 35px;
  padding-top: 2px;
}

.custompopover {
  width: 200px;
}

.daterangepicker .ranges ul {
  list-style: none;
  margin: 0 auto;
  padding: 0;
}
.daterangepicker .ranges ul li {
  font-size: 12px;
  padding: 5px 5px;
  cursor: pointer;
  margin-bottom: 3px;
}

.container-data-range-picker {
  background: #fff;
  cursor: pointer;
  padding: 5px 10px;
  border: 1px solid #ccc;
  width: 100%;
  border-radius: 4px;
}

.selectize-control.multi .selectize-input {
  padding: 2px 5px;
  min-height: 35px;
}

.skilli-downdown .selection .select2-selection--single, .skilli-downdown .selection .select2-selection--multiple {
  border-radius: 4px 4px 4px 4px !important;
}

@media (max-width: 1870px) {
  .btn-hidden-text span {
    display: none;
  }
}
@media (max-width: 971px) {
  .btn-hidden-text {
    margin-bottom: 10px;
  }
  .btn-hidden-text span {
    display: contents;
  }
}
.md-center-content {
  display: flex;
  justify-content: center;
}
.md-center-content .text-align-left {
  width: max-content;
}

.datepicker-dropdown {
  z-index: 10012 !important;
}

.support-form .panel-sign {
  width: 800px;
}

.label-success-transparent {
  border: 1px solid #1cba63;
  background-color: rgba(28, 186, 99, 0.2);
  padding: 5px 10px;
  color: #1cba63;
  font-size: 100% !important;
}

.label-warning-transparent {
  border: 1px solid #d9534f;
  background-color: rgba(217, 83, 79, 0.2);
  padding: 5px 10px;
  color: #d9534f;
  font-size: 100% !important;
}

.label-default-transparent {
  border: 1px solid #000;
  background-color: #fff;
  padding: 5px 10px;
  color: #000;
  font-size: 100% !important;
}

.wrapper_await {
  position: fixed;
  top: 50%;
  left: 50%;
  margin-left: -55px;
  margin-top: -50px;
}
.wrapper_await h1 {
  position: relative;
  top: -60px !important;
  left: -30px !important;
}
.wrapper_await div {
  position: absolute;
  height: 25px;
  width: 25px;
  transform-origin: 100% 50%;
}
.wrapper_await div .bar {
  position: absolute;
  height: 1px;
  width: 40px;
  background-color: #5C8825;
  left: 0;
  border-radius: 20px;
  transform-origin: right;
  animation: spin 9s linear infinite;
}

.wrapper_await div:nth-child(1) {
  transform: rotate(5deg);
}

.wrapper_await div:nth-child(2) {
  transform: rotate(10deg);
}

.wrapper_await div:nth-child(3) {
  transform: rotate(15deg);
}

.wrapper_await div:nth-child(4) {
  transform: rotate(20deg);
}

.wrapper_await div:nth-child(5) {
  transform: rotate(25deg);
}

.wrapper_await div:nth-child(6) {
  transform: rotate(30deg);
}

.wrapper_await div:nth-child(7) {
  transform: rotate(35deg);
}

.wrapper_await div:nth-child(8) {
  transform: rotate(40deg);
}

.wrapper_await div:nth-child(9) {
  transform: rotate(45deg);
}

.wrapper_await div:nth-child(10) {
  transform: rotate(50deg);
}

.wrapper_await div:nth-child(11) {
  transform: rotate(55deg);
}

.wrapper_await div:nth-child(12) {
  transform: rotate(60deg);
}

.wrapper_await div:nth-child(13) {
  transform: rotate(65deg);
}

.wrapper_await div:nth-child(14) {
  transform: rotate(70deg);
}

.wrapper_await div:nth-child(15) {
  transform: rotate(75deg);
}

.wrapper_await div:nth-child(16) {
  transform: rotate(80deg);
}

.wrapper_await div:nth-child(17) {
  transform: rotate(85deg);
}

.wrapper_await div:nth-child(18) {
  transform: rotate(90deg);
}

.wrapper_await div:nth-child(19) {
  transform: rotate(95deg);
}

.wrapper_await div:nth-child(20) {
  transform: rotate(100deg);
}

.wrapper_await div:nth-child(21) {
  transform: rotate(105deg);
}

.wrapper_await div:nth-child(22) {
  transform: rotate(110deg);
}

.wrapper_await div:nth-child(23) {
  transform: rotate(115deg);
}

.wrapper_await div:nth-child(24) {
  transform: rotate(120deg);
}

.wrapper_await div:nth-child(25) {
  transform: rotate(125deg);
}

.wrapper_await div:nth-child(26) {
  transform: rotate(130deg);
}

.wrapper_await div:nth-child(27) {
  transform: rotate(135deg);
}

.wrapper_await div:nth-child(28) {
  transform: rotate(140deg);
}

.wrapper_await div:nth-child(29) {
  transform: rotate(145deg);
}

.wrapper_await div:nth-child(30) {
  transform: rotate(150deg);
}

.wrapper_await div:nth-child(31) {
  transform: rotate(155deg);
}

.wrapper_await div:nth-child(32) {
  transform: rotate(160deg);
}

.wrapper_await div:nth-child(33) {
  transform: rotate(165deg);
}

.wrapper_await div:nth-child(34) {
  transform: rotate(170deg);
}

.wrapper_await div:nth-child(35) {
  transform: rotate(175deg);
}

.wrapper_await div:nth-child(36) {
  transform: rotate(180deg);
}

.wrapper_await div:nth-child(37) {
  transform: rotate(185deg);
}

.wrapper_await div:nth-child(38) {
  transform: rotate(190deg);
}

.wrapper_await div:nth-child(39) {
  transform: rotate(195deg);
}

.wrapper_await div:nth-child(40) {
  transform: rotate(200deg);
}

.wrapper_await div:nth-child(41) {
  transform: rotate(205deg);
}

.wrapper_await div:nth-child(42) {
  transform: rotate(210deg);
}

.wrapper_await div:nth-child(43) {
  transform: rotate(215deg);
}

.wrapper_await div:nth-child(44) {
  transform: rotate(220deg);
}

.wrapper_await div:nth-child(45) {
  transform: rotate(225deg);
}

.wrapper_await div:nth-child(46) {
  transform: rotate(230deg);
}

.wrapper_await div:nth-child(47) {
  transform: rotate(235deg);
}

.wrapper_await div:nth-child(48) {
  transform: rotate(240deg);
}

.wrapper_await div:nth-child(49) {
  transform: rotate(245deg);
}

.wrapper_await div:nth-child(50) {
  transform: rotate(250deg);
}

.wrapper_await div:nth-child(51) {
  transform: rotate(255deg);
}

.wrapper_await div:nth-child(52) {
  transform: rotate(260deg);
}

.wrapper_await div:nth-child(53) {
  transform: rotate(265deg);
}

.wrapper_await div:nth-child(54) {
  transform: rotate(270deg);
}

.wrapper_await div:nth-child(55) {
  transform: rotate(275deg);
}

.wrapper_await div:nth-child(56) {
  transform: rotate(280deg);
}

.wrapper_await div:nth-child(57) {
  transform: rotate(285deg);
}

.wrapper_await div:nth-child(58) {
  transform: rotate(290deg);
}

.wrapper_await div:nth-child(59) {
  transform: rotate(295deg);
}

.wrapper_await div:nth-child(60) {
  transform: rotate(300deg);
}

.wrapper_await div:nth-child(61) {
  transform: rotate(305deg);
}

.wrapper_await div:nth-child(62) {
  transform: rotate(310deg);
}

.wrapper_await div:nth-child(63) {
  transform: rotate(315deg);
}

.wrapper_await div:nth-child(64) {
  transform: rotate(320deg);
}

.wrapper_await div:nth-child(65) {
  transform: rotate(325deg);
}

.wrapper_await div:nth-child(66) {
  transform: rotate(330deg);
}

.wrapper_await div:nth-child(67) {
  transform: rotate(335deg);
}

.wrapper_await div:nth-child(68) {
  transform: rotate(340deg);
}

.wrapper_await div:nth-child(69) {
  transform: rotate(345deg);
}

.wrapper_await div:nth-child(70) {
  transform: rotate(350deg);
}

.wrapper_await div:nth-child(71) {
  transform: rotate(355deg);
}

.wrapper_await div:nth-child(72) {
  transform: rotate(360deg);
}

.wrapper_await div:nth-child(73) {
  transform: rotate(365deg);
}
@keyframes move4 {
  0% {
    transform: translate(0);
  }
  25% {
    transform: translate(-100%, 0);
    z-index: 0;
  }
  50% {
    transform: translate(-100%, -100%);
    z-index: 10;
  }
  75% {
    transform: translate(0, -100%);
  }
  100% {
    transform: translate(0);
  }
}
.has-error .selectize-control .selectize-input {
  border: 1px solid #d2322d;
}

.fade-element-in.ng-enter {
  transition: 0.8s linear all;
  opacity: 0;
}

.fade-element-in-init .fade-element-in.ng-enter {
  opacity: 1;
}

.fade-element-in.ng-enter.ng-enter-active {
  opacity: 1;
}

.fade-element-in.ng-leave {
  transition: 0.3s linear all;
  opacity: 1;
}

.fade-element-in.ng-leave.ng-leave-active {
  opacity: 0;
}

a.skillify-link {
  color: #333 !important;
  text-decoration: underline !important;
  transition: color 0.3s ease !important;
}

a:hover.skillify-link {
  color: #666 !important;
}

.container-copy-password {
  display: flex;
  flex-wrap: nowrap;
}

.skillify-custom-label .custom-error .form-control {
  border-color: #B94A48 !important;
}
.skillify-custom-label .control-label {
  font-size: 14px;
}

.btn-copy {
  padding: 7px !important;
  position: absolute;
  right: 0;
  top: 0;
}

.container-proctor-code {
  width: 400px;
}
.container-proctor-code .code-time {
  font-size: 18px;
}
.container-proctor-code .actions-btn, .container-proctor-code duration, .container-proctor-code data-code {
  width: 100%;
}
.container-proctor-code .input-group-btn {
  min-width: 120px;
}
.container-proctor-code .box {
  display: inline-block;
  position: relative;
  margin: 0 0.25rem;
  font-size: 0;
  line-height: 0;
}
.container-proctor-code .unit {
  text-align: center;
  font-size: 0.875rem;
  line-height: 1;
  font-weight: 600;
  margin: 0.25rem 0;
}
.container-proctor-code .value {
  min-width: 33px;
  font-size: 22px;
  font-size: 22px;
  line-height: 4rem;
  font-weight: 700;
  text-align: center !important;
  padding: 0.25rem;
  color: #000;
  border: 2.5px solid #000;
  border-radius: 5px;
  height: 50px;
  -webkit-user-select: none;
          user-select: none;
}
.container-proctor-code .value.vertical-center {
  font-size: 25px;
}
.container-proctor-code .value .icon {
  font-size: 20px !important;
}
.container-proctor-code .value .icon-slash {
  font-size: 19px !important;
}
.container-proctor-code .value .copy-code i {
  font-size: 1em !important;
}
.container-proctor-code .value a {
  text-decoration: none;
  color: inherit;
}
.container-proctor-code .value a:hover,
.container-proctor-code .value a:active,
.container-proctor-code .value a:focus {
  text-decoration: none;
  color: inherit;
}
.container-proctor-code .value a:hover i,
.container-proctor-code .value a:active i,
.container-proctor-code .value a:focus i {
  color: #000 !important;
}

.skillify-custom-label .custom-error .form-control {
  border-color: #B94A48 !important;
}
.skillify-custom-label .control-label {
  font-size: 14px;
}

.skilli-downdown .select2-selection--multiple li:not(.select2-search--inline) {
  border: none !important;
  border-radius: unset !important;
}
.skilli-downdown .select2-selection--multiple .select2-selection__choice__remove {
  float: right;
  padding-left: 3px;
  margin-left: 3px;
}
.skilli-downdown .select2-selection--multiple .select2-selection__rendered li:not(.select2-search--inline) {
  cursor: pointer;
  margin: 5px 3px 3px 0;
  padding: 2px 6px;
  background: #f2f2f2;
  color: #303030;
  border: 0 solid #d0d0d0 !important;
}

.gradebook-filter .skilli-downdown .selection .select2-selection--single {
  min-height: 35px;
  padding-top: 2px;
}

a.disabled {
  pointer-events: none;
  cursor: default;
  color: gray;
}

.multiselect-parent .dropdown-menu {
  max-width: 300px; /* o 100% si es dinámico */
  overflow-wrap: break-word;
}

/* Tables - Actions */
.table .actions .custom-action,
.table .actions-hover .custom-action {
  display: inline-block;
  margin-right: 5px;
  color: #666;
}
.table .actions .custom-action:last-child,
.table .actions-hover .custom-action:last-child {
  margin-right: 0;
}
.table .collapse {
  transition: all 0.5s linear 0s;
}
.table .collapse.in {
  display: table !important;
}
.table tbody tr td.notifications {
  display: table-cell;
  list-style: inherit;
  margin: 0;
}
.table tbody tr td.notifications .notification-icon {
  position: relative;
}
.table tbody tr td.notifications .notification-icon .badge {
  background: transparent;
  color: #000;
  font-size: 11px;
  font-weight: normal;
  height: 14px;
  padding: 3px 5px 3px 5px;
  position: absolute;
  right: -11px;
  top: -8px;
  border-radius: 100%;
}
.table.dataTable thead th {
  background: transparent !important;
  white-space: nowrap;
}
.table.dataTable thead .sorting:before,
.table.dataTable thead .sorting_asc:before,
.table.dataTable thead .sorting_desc:before,
.table.dataTable thead .sorting_asc_disabled:before,
.table.dataTable thead .sorting_desc_disabled:before {
  content: none !important;
}
.table.dataTable thead .sorting:after,
.table.dataTable thead .sorting_asc:after,
.table.dataTable thead .sorting_desc:after,
.table.dataTable thead .sorting_asc_disabled:after,
.table.dataTable thead .sorting_desc_disabled:after {
  bottom: 8px;
  right: 8px;
  font-family: "Font Awesome 5 Pro";
  padding-left: 10px;
  color: #005984;
  opacity: 0.5;
}
.table.dataTable thead .sorting:after {
  opacity: 0.2;
  content: "\f0dc";
}
.table.dataTable thead .sorting_asc:after {
  content: "\f0de";
}
.table.dataTable thead .sorting_desc:after {
  content: "\f0dd";
}
.table.dataTable thead .sorting_asc_disabled:after,
.table.dataTable thead .sorting_desc_disabled:after {
  color: #eee;
}

.table-responsive.table-dropdown {
  overflow-y: visible;
  overflow-x: visible;
}

.table-hover-custom .actions-remove-hover > .far + .far,
.table-hover-custom .actions-remove-hover:hover > .far,
.table-hover-custom .actions-remove-hover > td > .index + .far,
.table-hover-custom .actions-remove-hover:hover > td > .index {
  display: none;
}
.table-hover-custom .actions-remove-hover:hover > td > .index + .far,
.table-hover-custom .actions-remove-hover:hover > .far + .far {
  display: inherit;
}
.table-hover-custom .actions-remove-hover > td > .index + .far,
.table-hover-custom .actions-remove-hover > .far + .far {
  cursor: pointer;
}
.table-hover-custom .actions-remove-hover > td:first-child {
  min-width: 36px !important;
}

.total-questions {
  margin-left: 3px;
  font-weight: bold;
}

.dataTables_wrapper .datatables-header .dataTables_processing {
  min-height: 15vh;
  background: transparent !important;
  border-radius: 0;
  height: auto;
  box-shadow: none;
}
.dataTables_wrapper .table-responsive.initloader {
  min-height: 15vh;
}

.dataTables_scrollBody::-webkit-scrollbar-track {
  bottom: 0;
  position: absolute;
  top: 0;
  -webkit-transition: all 0.2s ease 0s;
  transition: all 0.2s ease 0s;
  width: 1px;
}
.dataTables_scrollBody::-webkit-scrollbar {
  width: 6px;
  height: 6px;
}
.dataTables_scrollBody::-webkit-scrollbar-thumb {
  background: #0088cc;
  margin: 0;
  position: relative;
  border-radius: 5px;
  height: 71px;
  width: 4px;
}
.dataTables_scrollBody thead tr {
  visibility: collapse;
  height: 0 !important;
}

.dataTables_filter.custom_filters {
  width: 70%;
  display: flex;
  float: right !important;
}
.dataTables_filter.custom_filters label {
  width: 100%;
}
.dataTables_filter.custom_filters input {
  border-top-right-radius: 0 !important;
  border-bottom-right-radius: 0 !important;
}
.dataTables_filter.custom_filters button {
  border-radius: 0;
  border-left: 0;
}
.dataTables_filter.custom_filters button:last-child {
  border-top-right-radius: 4px !important;
  border-bottom-right-radius: 4px !important;
}
.dataTables_filter button.pull-right {
  display: inline-flex;
}

.shell-sections td:last-child {
  width: 40px !important;
  /*padding-left: 15px;*/
  align-content: center;
}
.shell-sections .inputclpbd {
  display: none;
}

.table.ng-table thead th.header {
  position: inherit;
  background: none;
  border: none;
  height: initial;
  text-align: left;
}
.table.ng-table thead th:last-child {
  text-align: center;
}
.table.ng-table thead th.sort-asc {
  background: #e9ecef;
  text-shadow: unset;
}
.table.ng-table thead th.sort-desc {
  background: #e9ecef;
  text-shadow: unset;
}
.table.ng-table.options-left th:first-child {
  text-align: center;
}
.table.ng-table.options-left th:last-child {
  text-align: left;
}
.table.ng-table tr {
  font-size: 12px;
}
.table.ng-table .ng-table-container-message {
  width: 100%;
  text-align: center;
  display: table-caption;
  caption-side: bottom;
  background: #d3cecd;
  padding: 5px;
}
.table.ng-table .ng-table-container-message span {
  color: #444241;
}
.table.ng-table .ng-table-container-message .btn {
  background: #e6e6e6;
}

.ng-table:not(.skillify-horizon, .skillify-license-usage) th.sortable .sort-indicator {
  display: block !important;
}
.ng-table:not(.skillify-horizon, .skillify-license-usage) td:not(.actions) {
  white-space: nowrap !important;
  overflow: hidden;
  text-overflow: ellipsis;
  max-width: 115px !important;
}

.ng-table.skillify-license-usage th.sortable .sort-indicator {
  display: block !important;
}
.ng-table.skillify-license-usage td:not(.actions) {
  white-space: nowrap !important;
  overflow: hidden;
  text-overflow: ellipsis;
  max-width: 100px !important;
}
.ng-table.skillify-license-usage td:nth-child(n+5) {
  width: 75px !important;
}

.label-days-left {
  width: 45px;
  text-align: center;
  display: block;
}

.label-license-status {
  width: 55px;
  text-align: center;
  display: block;
}

.skillify-container-table {
  overflow-y: auto;
}
.skillify-container-table .skillify-horizon {
  width: 115% !important;
}

.btnsInput {
  padding-top: 26px;
}

@media (max-width: 991px) {
  .table.table-no-more td::before {
    content: attr(data-title-text) !important;
  }
}
.label-activity-type {
  width: 70px;
  text-align: center;
  display: block;
  height: 14px;
  margin-left: 1rem;
}

.label-activity-status {
  width: 66px;
  text-align: center;
  display: block;
  height: 14px;
  margin-left: 1rem;
}

#tableActivities th:nth-child(4) {
  text-align: center !important;
}
#tableActivities th:nth-child(5) {
  text-align: center !important;
}

.container-downloads {
  width: 100%;
  display: flex;
  justify-content: space-between;
  margin-bottom: 10px;
}

.container-gradebook {
  /* display: flex;
  overflow-x: auto;
  padding-bottom: 7px;*/
  display: flex;
  flex-wrap: nowrap;
  max-height: 450px;
  overflow: auto;
}
.container-gradebook .course-gradebook {
  display: ruby-base-container;
  /*display: block;*/
}
.container-gradebook .course-gradebook thead.customStyles {
  border-top: 1px solid #ddd;
}
.container-gradebook .course-gradebook thead.customStyles tr th {
  border: 1px solid #ddd;
  text-align: center;
  min-width: 50px !important;
  width: auto !important;
}
.container-gradebook .course-gradebook thead.customStyles tr th.vertical-align {
  vertical-align: middle !important;
}
.container-gradebook .course-gradebook tbody {
  border-bottom: 1.5px solid #ddd;
}
.container-gradebook .course-gradebook tbody .gradebook-btn-action {
  width: 150px !important;
  margin-top: 4px !important;
}
.container-gradebook .gb-view-score {
  display: flex;
  justify-content: center;
}

.skillify-status-activity .dropbtn {
  padding: 4px 10px;
  font-size: 16px;
  border: none;
  cursor: pointer;
}
.skillify-status-activity .dropdown {
  position: relative;
  display: inline-block;
}
.skillify-status-activity .dropdown:hover {
  /*.icon-btn {
      transform: rotate(180deg);

  }*/
}
.skillify-status-activity .dropdown:hover .dropdown-content {
  display: block;
}
.skillify-status-activity .dropdown-content {
  display: none;
  position: absolute;
  background-color: #f9f9f9;
  min-width: 160px;
  box-shadow: 0px 8px 16px 0px rgba(0, 0, 0, 0.2);
  z-index: 1;
}
.skillify-status-activity .dropdown-content .gradebook-options {
  color: black;
  padding: 5px 7px;
  text-decoration: none;
  display: block;
}
.skillify-status-activity .dropdown-content .gradebook-options:hover {
  background-color: #f1f1f1;
}
.skillify-status-activity .dropdown-content .gradebook-options i {
  padding-left: 5px;
}

.font-size-12 {
  font-size: 12px !important;
}

.font-size-10 {
  font-size: 10px !important;
}

.container-check {
  display: flex;
  align-items: center;
  justify-content: center;
}
.container-check .spin-working {
  display: flex;
}
.container-check .option-awards {
  display: flex;
}
.container-check .option-awards.hidden {
  display: none;
}

.border-r-transparent {
  border-right: 1px solid transparent !important;
}

.border-l-transparent {
  border-left: 1px solid transparent !important;
}

.skillify-status-activity .dropbtn {
  padding: 4px 10px;
  font-size: 16px;
  border: none;
  cursor: pointer;
}
.skillify-status-activity .dropdown {
  position: relative;
  display: inline-block;
}
.skillify-status-activity .dropdown:hover {
  /*.icon-btn {
      transform: rotate(180deg);

  }*/
}
.skillify-status-activity .dropdown:hover .dropdown-content {
  display: block;
}
.skillify-status-activity .dropdown-content {
  display: none;
  position: absolute;
  background-color: #f9f9f9;
  min-width: 160px;
  box-shadow: 0px 8px 16px 0px rgba(0, 0, 0, 0.2);
  z-index: 1;
}
.skillify-status-activity .dropdown-content .gradebook-options {
  color: black;
  padding: 5px 7px;
  text-decoration: none;
  display: block;
}
.skillify-status-activity .dropdown-content .gradebook-options:hover {
  background-color: #f1f1f1;
}
.skillify-status-activity .dropdown-content .gradebook-options i {
  padding-left: 5px;
}

.font-size-12 {
  font-size: 12px !important;
}

.font-size-10 {
  font-size: 10px !important;
}

.container-check {
  display: flex;
  align-items: center;
  justify-content: center;
}
.container-check .spin-working {
  display: flex;
}
.container-check .option-awards {
  display: flex;
}
.container-check .option-awards.hidden {
  display: none;
}
.container-check .option-labels label {
  min-width: 50px;
  padding: 3px 0;
}

.border-r-transparent {
  border-right: 1px solid transparent !important;
}

.border-l-transparent {
  border-left: 1px solid transparent !important;
}

.filter-drill-down .dropdown-menu-form {
  width: 300px;
}

.active-users-no-data {
  width: 100%;
  display: flex;
  justify-content: center;
  background: #d3cecd;
}
.active-users-no-data span {
  text-align: center;
  padding: 5px;
}

.hidden-td {
  display: none;
}

.tab-content.tab-content-shadow {
  border-radius: 3px;
  background: rgba(245, 249, 252, 0.25);
  transition: all 0.2s ease-in-out;
  box-shadow: 0 0 13px 0 rgba(22, 45, 61, 0.2);
  overflow: hidden;
  visibility: hidden;
  opacity: 0;
}
.tab-content.tab-content-shadow.tab-content-hide {
  visibility: hidden;
  opacity: 0;
}
.tab-content.tab-content-shadow.tab-content-show {
  margin-top: 20px;
  visibility: visible;
  opacity: 1;
}

.sidebar-left {
  transition: all 0.3s ease-in;
}
.sidebar-left .sidebar-header .sidebar-toggle {
  border: none;
}

@media only screen and (min-width: 768px) {
  html.left-sidebar-panel .inner-wrapper {
    padding-top: 85px;
  }
  html.left-sidebar-panel .content-body {
    padding: 0;
    margin-right: 25px;
  }
  html.left-sidebar-panel .page-header {
    display: inline-flex;
    flex-direction: column;
    width: 100%;
    margin-bottom: 15px;
  }
  html.left-sidebar-panel .sidebar-left {
    margin: 0 25px 25px;
    border-radius: 5px;
    overflow: hidden;
  }
  html.left-sidebar-panel.fixed .page-header {
    position: relative;
    left: 0;
    top: 0;
  }
  html.left-sidebar-panel.fixed .content-body {
    margin-left: 300px;
  }
  html.left-sidebar-panel.fixed .sidebar-left {
    margin: 25px;
    padding-bottom: 0;
  }
  html.left-sidebar-panel.fixed.sidebar-left-collapsed .page-header {
    left: 123px;
  }
  html.left-sidebar-panel.fixed.sidebar-left-collapsed .content-body {
    margin-left: 123px;
  }
  html.left-sidebar-panel.ie9.no-overflowscrolling .nano {
    min-height: 100vh;
  }
  html.left-sidebar-panel.ie9.no-overflowscrolling .nano > .nano-content {
    position: static;
  }
  html.left-sidebar-panel.ie9 .sidebar-left {
    left: 25px;
  }
  html.left-sidebar-panel.ie9 .content-body {
    padding-right: 70px;
    left: 50px;
  }
}
.userbox .profile-info {
  margin: 0 25px 0 3px;
}
.userbox [data-letters]:before {
  content: attr(data-letters);
  display: inline-block;
  font-size: 1em;
  width: 2.2em;
  height: 2.2em;
  line-height: 2.4em;
  text-align: center;
  border-radius: 50%;
  background: #C40606;
  vertical-align: middle;
  margin-right: 0px;
  color: white;
}

/*
======================================================================================================================================
// variables.scss
======================================================================================================================================
*/
/*
======================================================================================================================================
// icons.scss
======================================================================================================================================
*/
@font-face {
  font-family: VideoJS;
  src: url("../fonts/VideoJS.eot?#iefix") format("eot");
}
@font-face {
  font-family: VideoJS;
  src: url(data:application/font-woff;charset=utf-8;base64,d09GRgABAAAAAA/oAAoAAAAAGlAAAQAAAAAAAAAAAAAAAAAAAAAAAAAAAABPUy8yAAAA9AAAAD4AAABWUZFeFmNtYXAAAAE0AAAAOgAAAUriNhC2Z2x5ZgAAAXAAAAtdAAASvAMeMEpoZWFkAAAM0AAAACsAAAA2ENBQpWhoZWEAAAz8AAAAHAAAACQPbQi7aG10eAAADRgAAAATAAAAlASVAABsb2NhAAANLAAAAEwAAABMSoxPbG1heHAAAA14AAAAHwAAACABNgB5bmFtZQAADZgAAAElAAACCtXH9aBwb3N0AAAOwAAAASYAAAHc539EX3icY2Bk52acwMDKwMFSyPKMgYHhF4RmjmEIZzzHwMDEwMrMgBUEpLmmMDh8ZPyowg7iLmSHCDOCCADzEwpPAAB4nGNgYGBmgGAZBkYGEHAB8hjBfBYGDSDNBqQZGZgYGD6q/P8PUvCREUTzM0DVAwEjG8OIBwCWJQbbAAB4nO1XfXBTVRZ/576vpimpab6gtGle0ybQYilNk7SUJlEoYAu1lJbv2hYKtBaHAgN+VCQjWsfWAV1I2EU+XAcYBfzY3QEUB5bVXUZ0qKC2yDpodOUPQRmcBVTaXPfcl6aKRZfd/XebvnfvPffcc88953fPOY8DDv/ELrGLIxwHeiC1vEfs6rtAtBzHszmpVWrFOR2XynEaYhA4PoUTszgD4cDBOT2c18xZJI5chGM0EKJv0XkJCbAHSvG3JyGBzqNvRenLkgTV0ShUSxJ9meRDFf6eVedu5L/+9k/4orgOtyeqfgHUj+dk1FDRjwa9oodjkEt7SC3kwmrB3HdBMCOboOprk2ycxBm4LM6J/HngNFk8Xkm2+MCNCpvMKSCjFAXPKskmH3gtXpAtwilYXPsa/wZxrsgeJdJPz+/u7jtUD410J9sBfNPqKjtLflcfbdi2jQ827cjd/drw4ffOXzF5W80VWFS0tZBegYv1dCcN0C64Rt8sSd+aMmncb+uF8LZtqATTS9gn9nIiszHbmmghB9bQTqGBLRH20q7Bsy5BPolLiumu90FsgbgYFtfULO7XM31ol6pEdE/uDpj0owB+4PzJuE8S85chtjQmh8ejWyQim9BnDi4Sk0P+hueuXXx4dzfPd+8+D4qIh/9RqcjALuSf7IgHDtArhVuLYOHVq7Awbm8VOyKn5fScBXW26xW3nXe5XW4F7CZFb+dNLpNLT7RhWBMJhyO0kw9GYE04EgmTi7QzTBIj4f4gTpLnwki/qUwmQDGo0kCVbHCzbWB1JEw7I0waHGOSw0xMLY5xCGv6LkSQzsjcoG170bbJiA3EkQ5kvRUsCiJAnwc8IkIM9Af9tQC1fn6g7Q/yQbFH7fw40fcVH0QzD94NGW1t4EZyNm4U3hBwOFEyZKPNQVTAk+J1iIBWN1sUEbcDF5gRiV4gR6GpsuaJy42Qwm9wf/l7eomcj56ChxY0A/Qb6DnW6kh+9Aucg5QH6DmVmV7iL5PmFIA5VdR5/+5rPuqsiK5qAtg0fTp810R/2DR9agWS4SxNULngLDt2TNeBs1tQ14yhFgDFpIDiVkR82E/s6ZsVqCGkJiDsVds+M+TQXnIhaiYX8LL3Qg7rDTFPdH+I9oRCoXAojkd1Xyfnv8medrfdhB41GSXZHkOp12UFkxinIzvS3fpCD6NbWGDyM138gllto61toVBbji1iywFQG6JllFg/Rh+q4bfZkezy2Ar8V9vyoaS4j23CNTX2aAesxxlcCL+Bh1lMzx6T4o6E1D/IFUx9F2MP7w5jVIRjIRpgHVIbCnED8QDv6TIuDweZkgyeQidYwYXHRyvgoY0WvPx27OChCzxejFTYUWfFQG65NfqVLJNka+WY+nWErKvHtxz9ZnA4ptJKjCLw7QsWtPN8O7k7YyR4R3hGQGG6LcaN75Ej6Mm0gaEtjb5jSV3QTkj7grr2gbsizUVsT+TuRg1RO68PnHweJINjLAtL6MdkVMrpkGReMmeAZLTIOrAYrOAHHMY87AeP12L2eA0eh5PFINQfJ3Qg7hPFHYmSHJZHDDs8flIab0ymvclGklZWfHhYqhySRe12UdyuFbGbOuxwcVkaMSZDzo0c0aLlmwnZvFx9896s8qx2Teow4JM0YsXtacd1eoybuuNpt1eImiQaTRqpaR9gwcFNWHDhSM0dcXn45gb9xO44JkNDPO1lC1zoZymOpTE+ODT5xePOgAwWy34hf95s9ZDUKbXeWtLkb9jT/iu7IsLijrklDdIH8VO/7ta0IXcPYpSsuyFHJ2McyuZG/0JUwNuFEaAEFKTrcV7x4m276f1vw/9w/NLSXrz+kg05fsrZ/yhey2NvvKEyIGNb5Nf8YpA14NSAV4Ph+mZWKWqhV+iVFtDSqy2QBEkt9OpNbdGvv4EHtLguhimxVzrImVktoAG9eieYG+zoEzU346ZdsPpoVBSjR/EdkmAGpTADTfqK2IVBuAunc4Ton2MclL4iDXDEMSv6sVQyMvn2TCkdFB7TpZ7Fq0KPq0D0b581AbKdlHb/8MOplzZJV+h3U6ceoR9FNeRbGPX3wye5QT9tQDn5XBnXwC1DaUYrbzLKkmDPdDgdKMvrwTTnLvRKSGBDH7gU2Y7x26jjnRi2PO7CPIIayJIJlxoKfAQJMBZjCHHYM3UozEowuaOz3XZM6y4+IzB/XiB/Kr2w87Hzxdlzy9eD3pZhyjNvfneqf/oHbfB85/ryaePKJo/7jaMq1Z3pvzeQM2PEWGNu6VzP+Nb5Xl2ywZqYll15m83dvHymZ/KKtXxrT0/Lhx+28F9klU2sClbOm/nQqpkNE6bM6MyrTskJjM4aJ/xlc/VWz52BOf6n5k1dNaUk4FNGFi8Z37G22qmULM5burS6sH9LauE9vhH5WcPtWkt6EdFlFdWVTG4tSeeXLfv442VnB+5bEOM5j3Vyjlrj6cEs5UKmo9BTYGbDQkfMEHol5baxmGvtPt6FM+foQaiHpTWkumnpniZhIz00Y5a/1qSlhwgA3EWMOVOW+vedEjb2K/ynUHDXwoWbGhv7z0XfJikt95e5rK7oGdgIl/Pzn7blF2X8Ix6zNmPqGocDSTabjEQHgt3mNLsKWHaJNaVYhqi+MwsWhwoLtUj2SJsn1sO0Z3vp+/vpN5/Zcz97tWVPhpKWm9O2aVLlnZVjHoT5xxOOdDzVcF9Ddkud2LywTJf2KI1eOnTfM0InWdsoai1/WC04+DEbZs6pCP0p0ZHVcWSJqXiVP3EQm0HEVCYOGOqlPN6tt7t9AmKnBM2EJR5iwusR86ssr85tfqmtUnlh6spJ+ZjOZOEKTKd/HGabmF8J731t9wEpWvDAA+OJ7Uzq7Lrls28XZTqnP3rdWui2AhmwQ1AKcuUMuQRB6/T4WZItwA8BhGEMgGaLmaUpjzNmBLQWA7OXIZU5zGS08JLFgaOULJuQIgW76c7Ty1tLDB7jvaUPHm2+//MNLQfXzc+tmm5NSJCIpHedfnHLi0+2lpbrErItngLfrBGL9EI37YZGeB4au/ngabqz21Y35QNn8ZOXwyvffmR8w9qOic07bEm2jOGSxVg6b8vZXev3Xppdal89N6PgzpW1d42j90xunQ8Pf3kaBeD+HPsOYi/hPUSbBfFWylVx87g6hjuPlcjMrg670+HF3OtxyHqjaGZ3kznfLqnJGVP1z0lGaQgJM7XLD1h72yU+2+Tk0x47uXl+wrB9j055KQFgb01zombFIngkU9HZc4FU5KeDkJhVSMC3CEmZYxjJCiKSwD+EAr7v11+647O9J8e8D84NcIJExeQlR4Kdx5JFkeffIrXTlq4SaUh+U3anTwjPXvu6T6u5zf/CohVHpt0CpboJFvNJU+iB9d/DT+qtg5hx1EjPYi5+UrhjeRBBxyovPWGB93P6uIzpKkJ7JHB+8gk4JdoTYQUWfVw6gC/6efQay2W1ITYn0bOfhKL7cAFJRJO1x+Nmk3gOq27mnVysHEwuVtua2KaYfPUmAUtIrCPUvIdJTmG4j6U+5/YTZMWsjUeEDpF+dwII1MgdCbSR/lUM9E0ungYdwmE6Gs5gD6YVw9fvzFpJYNgT/JGnT4BGhKQOie6nUZgAz8lwhlSMP3Giv+YJbPn94yvI/3X733Q7iDXLf6VbRYR/pH7HB0JIRLRAOrQnhDQ0n+4Se64fw6+SkBiIXiXa2PcJfrAiuiA3LLy/kwEMckIq6KAOTiUQLdYzkUjfhVC8Aop/28XtZuKsXMEQ7TDdIMwVuGUDCq/317wL2QF4uG/Kf2rM3rYy+vFx6P03NlXrL/ldaRbWXzrUGHVx4qNXZEVDTkvX6dpnYPn1Kmh5ij4C6aSBNEi1fa/vIjRKdtEt5KPoKO5faKTQLgAAAHicY2BkYGAA4jsiH5jj+W2+MnCzM4DAlc9NV5Bp9tNgcQ4GJhAFAD0ACrQAeJxjYGRgYGcAgoUcU0EU+2kGRgZUoAoAMVICP3icY2dgYGAfRJhjKgMDAE87AZoAAAAAAAAOAFAAZgCyAMYA5gEeAUgBdAGcAfICLgKOAroDCgOOA7AD6gQ4BHwEuAToBQwFogXoBjYGbAbaB3IHqAf2CEQIkgjgCTwJXnicY2BkYGBQZchlYGcAASYg5gJCBob/YD4DABd3AbAAeJxdkE1qg0AYhl8Tk9AIoVDaVSmzahcF87PMARLIMoFAl0ZHY1BHdBJIT9AT9AQ9RQ9Qeqy+yteNMzDzfM+88w0K4BY/cNAMB6N2bUaPPBLukybCLvleeAAPj8JD+hfhMV7hC3u4wxs7OO4NzQSZcI/8Ltwnfwi75E/hAR7wJTyk/xYeY49fYQ/PztM+jbTZ7LY6OWdBJdX/pqs6NYWa+zMxa13oKrA6Uoerqi/JwtpYxZXJ1coUVmeZUWVlTjq0/tHacjmdxuL90OR8O0UEDYMNdtiSEpz5XQGqzlm30kzUdAYFFOb8R7NOZk0q2lwAyz1i7oAr1xoXvrOgtYhZx8wY5KRV269JZ5yGpmzPTjQhvY9je6vEElPOuJP3mWKnP5M3V+YAAAB4nG2P13LDIBBFdW1LcotL7PRe/KiZJH+E0VpijEChxMnfB7eJHrIPcM/OAoeoFe1rGv1fiyhCC210ECNBii566GOAIU4wwhgTTHGKGeY4wzkucIkrXOMGt7jDPR7wiCc84wWvWHRqyX4G2yXjwnBJcc28pcGXlr6irPKO+ocs9eYYK5EfJ0pRlJOVl9JyQ6QyUo7MuNn4Fi6xn54ZSm0tlCLTs37phJNku5zVTmgVQhkSGRvbMky2uS6SvdBov2XaOykUzQ64u+jg3CrzhDPFSSaGtn/prhinpdbruKilt91wcE25UKnbCBdeSZyvltL0gk4gsm7KfC50llOQFjujeNfpF1oXkjizbvgXs7cmvDfhY94AroMkd5SnTJitVxT9AvnNiqQAAA==) format("woff"), url(data:application/x-font-ttf;charset=utf-8;base64,AAEAAAAKAIAAAwAgT1MvMlGRXhYAAAEoAAAAVmNtYXDiNhC2AAACFAAAAUpnbHlmAx4wSgAAA6wAABK8aGVhZBDQUKUAAADQAAAANmhoZWEPbQi7AAAArAAAACRobXR4BJUAAAAAAYAAAACUbG9jYUqMT2wAAANgAAAATG1heHABNgB5AAABCAAAACBuYW1l1cf1oAAAFmgAAAIKcG9zdOd/RF8AABh0AAAB3AABAAAHAAAAAKEIlQAAAAAHywABAAAAAAAAAAAAAAAAAAAAJQABAAAAAQAA3BVRs18PPPUACwcAAAAAANTzgtQAAAAA1POC1AAAAAAHywcAAAAACAACAAAAAAAAAAEAAAAlAG0ABwAAAAAAAgAAAAoACgAAAP8AAAAAAAAAAQcLAZAABQAIBHEE5gAAAPoEcQTmAAADXABXAc4AAAIABQMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUGZFZABA8QHxJAcAAAAAoQcAAAAAAAABAAAAAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAACJUAAAAAAAMAAAADAAAAHAABAAAAAABEAAMAAQAAABwABAAoAAAABgAEAAEAAgAA8ST//wAAAADxAf//AAAPAAABAAAAAAAAAAABBgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOAFAAZgCyAMYA5gEeAUgBdAGcAfICLgKOAroDCgOOA7AD6gQ4BHwEuAToBQwFogXoBjYGbAbaB3IHqAf2CEQIkgjgCTwJXgABAAAAAAWLBYsAAgAAAREBAlUDNgWL++oCCwAAAwAAAAAGawZrAAIADgAaAAAJAhMEAAMSAAUkABMCAAEmACc2ADcWABcGAALrAcD+QJX+w/5aCAgBpgE9AT0BpggI/lr+w/3+rgYGAVL9/QFSBgb+rgIwAVABUAGbCP5a/sP+w/5aCAgBpgE9AT0BpvrIBgFS/f0BUgYG/q79/f6uAAAAAgAAAAAFQAWLAAMABwAAASERKQERIREBwAEr/tUCVQErAXUEFvvqBBYAAAAEAAAAAAYgBiAABgATACQAJwAAAS4BJxUXNjcGBxc+ATUmACcVFhIBBwEhESEBEQEGBxU+ATcXNwEHFwTQAWVVuAO7AidxJSgF/t/lpc77t18BYf6fASsBdQE+TF1OijuZX/1gnJwDgGSeK6W4GBhqW3FGnFT0AWM4mjT+9AHrX/6f/kD+iwH2/sI7HZoSRDGYXwSWnJwAAAEAAAAABKsF1gAFAAABESEBEQECCwEqAXb+igRg/kD+iwSq/osAAAACAAAAAAVmBdYABgAMAAABLgEnET4BAREhAREBBWUBZVRUZfwRASsBdf6LA4Bkniv9piueAUT+QP6LBKr+iwAAAwAAAAAGIAYPAAUADAAaAAATESEBEQEFLgEnET4BAxUWEhcGAgcVNgA3JgDgASsBdf6LAsUBZVVVZbqlzgMDzqXlASEFBf7fBGD+QP6LBKr+i+Bkniv9piueAvOaNP70tbX+9DSaOAFi9fUBYgAAAAQAAAAABYsFiwAFAAsAEQAXAAABIxEhNSMDMzUzNSEBIxUhESMDFTMVMxECC5YBduCWluD+igOA4AF2luDglgLr/oqWAgrglvyAlgF2AqCW4AF2AAQAAAAABYsFiwAFAAsAEQAXAAABMxUzESETIxUhESMBMzUzNSETNSMRITUBdeCW/org4AF2lgHAluD+ipaWAXYCVeABdgHAlgF2++rglgHA4P6KlgAAAAACAAAAAAXWBdYADwATAAABIQ4BBxEeARchPgE3ES4BAyERIQVA/IA/VQEBVT8DgD9VAQFVP/yAA4AF1QFVP/yAP1UBAVU/A4A/VfvsA4AAAAYAAAAABmsGawAHAAwAEwAbACAAKAAACQEmJw4BBwElLgEnAQUhATYSNyYFAQYCBxYXIQUeARcBMwEWFz4BNwECvgFkTlSH8GEBEgOONemh/u4C5f3QAXpcaAEB/BP+3VxoAQEOAjD95DXpoQESeP7dTlSH8GH+7gPwAmgSAQFYUP4nd6X2Pv4nS/1zZAEBk01NAfhk/v+TTUhLpfY+Adn+CBIBAVhQAdkAAAAFAAAAAAZrBdYADwATABcAGwAfAAABIQ4BBxEeARchPgE3ES4BASEVIQEhNSEFITUhNSE1IQXV+1ZAVAICVEAEqkBUAgJU+xYBKv7WAur9FgLqAcD+1gEq/RYC6gXVAVU//IA/VQEBVT8DgD9V/ayV/tWVlZWWlQADAAAAAAYgBdYADwAnAD8AAAEhDgEHER4BFyE+ATcRLgEBIzUjFTM1MxUUBgcjLgEnET4BNzMeARUFIzUjFTM1MxUOAQcjLgE1ETQ2NzMeARcFi/vqP1QCAlQ/BBY/VAICVP1rcJWVcCog4CAqAQEqIOAgKgILcJWVcAEqIOAgKiog4CAqAQXVAVU//IA/VQEBVT8DgD9V/fcl4CVKICoBASogASogKgEBKiBKJeAlSiAqAQEqIAEqICoBASogAAAGAAAAAAYgBPYAAwAHAAsADwATABcAABMzNSMRMzUjETM1IwEhNSERITUhERUhNeCVlZWVlZUBKwQV++sEFfvrBBUDNZb+QJUBwJX+QJb+QJUCVZWVAAAAAQAAAAAGIAZsAC4AAAEiBgcBNjQnAR4BMz4BNy4BJw4BBxQXAS4BIw4BBx4BFzI2NwEGBx4BFz4BNy4BBUArSh797AcHAg8eTixffwICf19ffwIH/fEeTixffwICf18sTh4CFAUBA3tcXHsDA3sCTx8bATcZNhkBNB0gAn9fX38CAn9fGxn+zRwgAn9fX38CIBz+yhcaXHsCAntcXXsAAAIAAAAABlkGawBDAE8AAAE2NCc3PgEnAy4BDwEmLwEuASchDgEPAQYHJyYGBwMGFh8BBhQXBw4BFxMeAT8BFh8BHgEXIT4BPwE2NxcWNjcTNiYnBS4BJz4BNx4BFw4BBasFBZ4KBgeWBxkNujpEHAMUD/7WDxQCHEU5ug0aB5UHBQudBQWdCwUHlQcaDbo5RRwCFA8BKg8UAhxFOboNGgeVBwUL/ThvlAIClG9vlAIClAM3JEokewkaDQEDDAkFSy0cxg4RAQERDsYcLUsFCQz+/QwbCXskSiR7CRoN/v0MCQVLLRzGDhEBAREOxhwtSwUJDAEDDBsJQQKUb2+UAgKUb2+UAAAAAAEAAAAABmsGawALAAATEgAFJAATAgAlBACVCAGmAT0BPQGmCAj+Wv7D/sP+WgOA/sP+WggIAaYBPQE9AaYICP5aAAAAAgAAAAAGawZrAAsAFwAAAQQAAxIABSQAEwIAASYAJzYANxYAFwYAA4D+w/5aCAgBpgE9AT0BpggI/lr+w/3+rgYGAVL9/QFSBgb+rgZrCP5a/sP+w/5aCAgBpgE9AT0BpvrIBgFS/f0BUgYG/q79/f6uAAADAAAAAAZrBmsACwAXACMAAAEEAAMSAAUkABMCAAEmACc2ADcWABcGAAMOAQcuASc+ATceAQOA/sP+WggIAaYBPQE9AaYICP5a/sP9/q4GBgFS/f0BUgYG/q4dAn9fX38CAn9fX38Gawj+Wv7D/sP+WggIAaYBPQE9Aab6yAYBUv39AVIGBv6u/f3+rgJPX38CAn9fX38CAn8AAAAEAAAAAAYgBiAADwAbACUAKQAAASEOAQcRHgEXIT4BNxEuAQEjNSMVIxEzFTM1OwEhHgEXEQ4BByE3MzUjBYv76j9UAgJUPwQWP1QCAlT9a3CVcHCVcJYBKiAqAQEqIP7WcJWVBiACVD/76j9UAgJUPwQWP1T8gpWVAcC7uwEqIP7WICoBcOAAAgAAAAAGawZrAAsAFwAAAQQAAxIABSQAEwIAEwcJAScJATcJARcBA4D+w/5aCAgBpgE9AT0BpggI/lo4af70/vRpAQv+9WkBDAEMaf71BmsI/lr+w/7D/loICAGmAT0BPQGm/BFpAQv+9WkBDAEMaf71AQtp/vQAAQAAAAAF1ga2ABYAAAERCQERHgEXDgEHLgEnIxYAFzYANyYAA4D+iwF1vv0FBf2+vv0FlQYBUf7+AVEGBv6vBYsBKv6L/osBKgT9v779BQX9vv7+rwYGAVH+/gFRAAAAAQAAAAAFPwcAABQAAAERIyIGHQEhAyMRIREjETM1NDYzMgU/nVY8ASUn/v7O///QrZMG9P74SEi9/tj9CQL3ASjaus0AAAAABAAAAAAGjgcAADAARQBgAGwAAAEUHgMVFAcGBCMiJicmNTQ2NzYlLgE1NDcGIyImNTQ2Nz4BMyEHIx4BFRQOAycyNjc2NTQuAiMiBgcGFRQeAxMyPgI1NC4BLwEmLwImIyIOAxUUHgIBMxUjFSM1IzUzNTMDH0BbWkAwSP7qn4TlOSVZSoMBESAfFS4WlMtIP03TcAGiioNKTDFFRjGSJlAaNSI/akAqURkvFCs9WTY6a1s3Dg8THgocJU4QIDVob1M2RnF9A2vV1WnU1GkD5CRFQ1CATlpTenNTYDxHUYouUhIqQCkkMQTBlFKaNkJAWD+MWkhzRztAPiEbOWY6hn1SJyE7ZS5nZ1I0/JcaNF4+GTAkGCMLFx04Ag4kOF07Rms7HQNsbNvbbNkAAwAAAAAGgAZsAAMADgAqAAABESERARYGKwEiJjQ2MhYBESERNCYjIgYHBhURIRIQLwEhFSM+AzMyFgHd/rYBXwFnVAJSZGemZASP/rdRVj9VFQv+twIBAQFJAhQqR2c/q9AEj/whA98BMkliYpNhYfzd/cgCEml3RTMeM/3XAY8B8DAwkCAwOB/jAAABAAAAAAaUBgAAMQAAAQYHFhUUAg4BBCMgJxYzMjcuAScWMzI3LgE9ARYXLgE1NDcWBBcmNTQ2MzIXNjcGBzYGlENfAUyb1v7SrP7x4SMr4bBpph8hHCsqcJNETkJOLHkBW8YIvYaMYG1gJWldBWhiRQ4cgv797rdtkQSKAn1hBQsXsXUEJgMsjlNYS5WzCiYkhr1mFTlzPwoAAAABAAAAAAWABwAAIgAAARcOAQcGLgM1ESM1PgQ3PgE7AREhFSERFB4CNzYFMFAXsFlorXBOIahIckQwFAUBBwT0AU3+sg0gQzBOAc/tIz4BAjhceHg6AiDXGlddb1ctBQf+WPz9+h40NR4BAgABAAAAAAaABoAASgAAARQCBCMiJzY/AR4BMzI+ATU0LgEjIg4DFRQWFxY/ATY3NicmNTQ2MzIWFRQGIyImNz4CNTQmIyIGFRQXAwYXJgI1NBIkIAQSBoDO/p/Rb2s7EzYUaj15vmh34o5ptn9bK1BNHggIBgIGETPRqZepiWs9Sg4IJRc2Mj5WGWMRBM7+zgFhAaIBYc4DgNH+n84gXUfTJzmJ8JZyyH46YH2GQ2ieIAwgHxgGFxQ9WpfZpIOq7lc9I3VZHzJCclVJMf5eRmtbAXzp0QFhzs7+nwAABwAAAAAHAATPAA4AFwAqAD0AUABaAF0AAAERNh4CBw4BBwYmIycmNxY2NzYmBxEUBRY2Nz4BNy4BJyMGHwEeARcOARcWNjc+ATcuAScjBh8BHgEXFAYXFjY3PgE3LgEnIwYfAR4BFw4BBTM/ARUzESMGAyUVJwMchM2UWwgNq4JHrQgBAapUaAoJcWMBfiIhDiMrAQJLMB0BBAokNAIBPmMiIQ4iLAECSzAeAQUKJDQBP2MiIQ4iLAECSzAeAQUKJDQBAT75g+5B4arNLNIBJ44ByQL9BQ9mvYCKwA8FBQMDwwJVTGdzBf6VB8IHNR08lld9uT4LCRA/qGNxvUwHNR08lld9uT4LCRA/qGNxvUwHNR08lld9uT4LCRA/qGNxvVJkAWUDDEf+tYP5AQAAAAEAAAAABiAGtgAbAAABBAADER4BFzMRITU2ADcWABcVIREzPgE3EQIAA4D+4v6FBwJ/X+D+1QYBJ97eAScG/tXgX38CB/6FBrUH/oX+4v32X38CAlWV3gEnBgb+2d6V/asCf18CCgEeAXsAAAQAAAAABmQF3QAFAA4AFwArAAATFTMuAScRFR4BFzMmACcRFQQAEzMCACUBIQ4BBxUzNSERIRUhPgE3ES4BJ53JAnFWj70EhgX++MkBAgFUB4YI/mH+xAVA+0Y5TAGGBLr+KQHXOUwBAUw5Ae3KVnICAQ2HA72QyQEJBQEMhgb+rP79ATwBoAcB1wJLOsnJ/FSHAks6A6w6SwIAAAQAAAAABmQF3QAFAA4AFwArAAATFTMuAScRFR4BFzMmACcRFQQAEzMCACUBIQ4BBxUzNSERIRUhPgE3ES4BJ53JAnFWj70EhgX++MkBAgFUB4YI/mH+xAVA+0Y5TAGGBLr+KQHXOUwBAUw5Ae3KVnICAQ2HA72QyQEJBQEMhgb+rP79ATwBoAcB1wJLOsnJ/FSHAks6A6w6SwIAAAQAAAAABmQF3QAFAA4AFwArAAATFTMuAScRFR4BFzMmACcRFQQAEzMCACUBIQ4BBxUzNSERIRUhPgE3ES4BJ53JAnFWj70EhgX++MkBAgFUB4YI/mH+xAVA+0Y5TAGGBLr+KQHXOUwBAUw5Ae3KVnICAQ2HA72QyQEJBQEMhgb+rP79ATwBoAcB1wJLOsnJ/FSHAks6A6w6SwIAAAQAAAAABrYGIAAFAA4AFwArAAATFTMuAScRFR4BFzMmACcRFQQAEzMCACUBIQ4BBxUzNSERIRUhPgE3ES4BJ0vgA35fntMElQX+2d4BHQF7CJUJ/jD+pAXV+sA/VQGVBUD99QILP1UBAVU/AcDgX38CASuWBNKf3gEnBgEqlQf+hf7iAV0B0AgCCwJUP+Dg++qVAlQ/BBY/VAIAAAUAAAAABmQF3QAFAA4AFQAeADIAABMVMy4BJxEVHgEXMyYAJwEhFRYAFyEBFQQAEzMCACUBIQ4BBxUzNSERIRUhPgE3ES4BJ53JAnFWj70EhgX++MkEufxUywElQAF8+0cBAgFUB4YI/mH+xAVA+0Y5TAGGBLr+KQHXOUwBAUw5Ae3KVnICAQ2HA72QyQEJBQHWcEX+28YB1oYG/qz+/QE8AaAHAdcCSzrJyfxUhwJLOgOsOksCAAACAAAAAAfLBlYACwAOAAATIREhJyERIREhByEJAtEG+v59kQFv+lABaYz+fgEdAmACYAZV+7mkAv79AqT+lwLY/SgAAAAAEADGAAEAAAAAAAEABwAAAAEAAAAAAAIABwAHAAEAAAAAAAMABwAOAAEAAAAAAAQABwAVAAEAAAAAAAUACwAcAAEAAAAAAAYABwAnAAEAAAAAAAoAKwAuAAEAAAAAAAsAEwBZAAMAAQQJAAEADgBsAAMAAQQJAAIADgB6AAMAAQQJAAMADgCIAAMAAQQJAAQADgCWAAMAAQQJAAUAFgCkAAMAAQQJAAYADgC6AAMAAQQJAAoAVgDIAAMAAQQJAAsAJgEeVmlkZW9KU1JlZ3VsYXJWaWRlb0pTVmlkZW9KU1ZlcnNpb24gMS4wVmlkZW9KU0dlbmVyYXRlZCBieSBzdmcydHRmIGZyb20gRm9udGVsbG8gcHJvamVjdC5odHRwOi8vZm9udGVsbG8uY29tAFYAaQBkAGUAbwBKAFMAUgBlAGcAdQBsAGEAcgBWAGkAZABlAG8ASgBTAFYAaQBkAGUAbwBKAFMAVgBlAHIAcwBpAG8AbgAgADEALgAwAFYAaQBkAGUAbwBKAFMARwBlAG4AZQByAGEAdABlAGQAIABiAHkAIABzAHYAZwAyAHQAdABmACAAZgByAG8AbQAgAEYAbwBuAHQAZQBsAGwAbwAgAHAAcgBvAGoAZQBjAHQALgBoAHQAdABwADoALwAvAGYAbwBuAHQAZQBsAGwAbwAuAGMAbwBtAAAAAgAAAAAAAAARAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAlAAABAgEDAQQBBQEGAQcBCAEJAQoBCwEMAQ0BDgEPARABEQESARMBFAEVARYBFwEYARkBGgEbARwBHQEeAR8BIAEhASIBIwEkASUEcGxheQtwbGF5LWNpcmNsZQVwYXVzZQt2b2x1bWUtbXV0ZQp2b2x1bWUtbG93CnZvbHVtZS1taWQLdm9sdW1lLWhpZ2gQZnVsbHNjcmVlbi1lbnRlcg9mdWxsc2NyZWVuLWV4aXQGc3F1YXJlB3NwaW5uZXIJc3VidGl0bGVzCGNhcHRpb25zCGNoYXB0ZXJzBXNoYXJlA2NvZwZjaXJjbGUOY2lyY2xlLW91dGxpbmUTY2lyY2xlLWlubmVyLWNpcmNsZQJoZAZjYW5jZWwGcmVwbGF5CGZhY2Vib29rBWdwbHVzCGxpbmtlZGluB3R3aXR0ZXIGdHVtYmxyCXBpbnRlcmVzdBFhdWRpby1kZXNjcmlwdGlvbgVhdWRpbwpnb29nbGVjYXN0DGdvb2dsZWNhc3QtMAxnb29nbGVjYXN0LTEMZ29vZ2xlY2FzdC0yFGdvb2dsZWNhc3QtY29ubmVjdGVkB2FpcnBsYXkAAA==) format("truetype");
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-play, .video-js .vjs-big-play-button .vjs-icon-placeholder,
.video-js .vjs-play-control .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-play:before, .video-js .vjs-big-play-button .vjs-icon-placeholder:before,
.video-js .vjs-play-control .vjs-icon-placeholder:before {
  content: "\f101";
}

.vjs-icon-play-circle {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-play-circle:before {
  content: "\f102";
}

.vjs-icon-pause, .video-js .vjs-play-control.vjs-playing .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-pause:before, .video-js .vjs-play-control.vjs-playing .vjs-icon-placeholder:before {
  content: "\f103";
}

.vjs-icon-volume-mute, .video-js .vjs-mute-control.vjs-vol-0 .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-volume-mute:before, .video-js .vjs-mute-control.vjs-vol-0 .vjs-icon-placeholder:before {
  content: "\f104";
}

.vjs-icon-volume-low, .video-js .vjs-mute-control.vjs-vol-1 .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-volume-low:before, .video-js .vjs-mute-control.vjs-vol-1 .vjs-icon-placeholder:before {
  content: "\f105";
}

.vjs-icon-volume-mid, .video-js .vjs-mute-control.vjs-vol-2 .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-volume-mid:before, .video-js .vjs-mute-control.vjs-vol-2 .vjs-icon-placeholder:before {
  content: "\f106";
}

.vjs-icon-volume-high, .video-js .vjs-mute-control .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-volume-high:before, .video-js .vjs-mute-control .vjs-icon-placeholder:before {
  content: "\f107";
}

.vjs-icon-fullscreen-enter, .video-js .vjs-fullscreen-control .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-fullscreen-enter:before, .video-js .vjs-fullscreen-control .vjs-icon-placeholder:before {
  content: "\f108";
}

.vjs-icon-fullscreen-exit, .video-js.vjs-fullscreen .vjs-fullscreen-control .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-fullscreen-exit:before, .video-js.vjs-fullscreen .vjs-fullscreen-control .vjs-icon-placeholder:before {
  content: "\f109";
}

.vjs-icon-square {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-square:before {
  content: "\f10a";
}

.vjs-icon-spinner {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-spinner:before {
  content: "\f10b";
}

.vjs-icon-subtitles, .video-js .vjs-subtitles-button .vjs-icon-placeholder,
.video-js .vjs-subs-caps-button .vjs-icon-placeholder,
.video-js.video-js:lang(en-GB) .vjs-subs-caps-button .vjs-icon-placeholder,
.video-js.video-js:lang(en-IE) .vjs-subs-caps-button .vjs-icon-placeholder,
.video-js.video-js:lang(en-AU) .vjs-subs-caps-button .vjs-icon-placeholder,
.video-js.video-js:lang(en-NZ) .vjs-subs-caps-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-subtitles:before, .video-js .vjs-subtitles-button .vjs-icon-placeholder:before,
.video-js .vjs-subs-caps-button .vjs-icon-placeholder:before,
.video-js.video-js:lang(en-GB) .vjs-subs-caps-button .vjs-icon-placeholder:before,
.video-js.video-js:lang(en-IE) .vjs-subs-caps-button .vjs-icon-placeholder:before,
.video-js.video-js:lang(en-AU) .vjs-subs-caps-button .vjs-icon-placeholder:before,
.video-js.video-js:lang(en-NZ) .vjs-subs-caps-button .vjs-icon-placeholder:before {
  content: "\f10c";
}

.vjs-icon-captions, .video-js .vjs-captions-button .vjs-icon-placeholder,
.video-js:lang(en) .vjs-subs-caps-button .vjs-icon-placeholder,
.video-js:lang(fr-CA) .vjs-subs-caps-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-captions:before, .video-js .vjs-captions-button .vjs-icon-placeholder:before,
.video-js:lang(en) .vjs-subs-caps-button .vjs-icon-placeholder:before,
.video-js:lang(fr-CA) .vjs-subs-caps-button .vjs-icon-placeholder:before {
  content: "\f10d";
}

.vjs-icon-chapters, .video-js .vjs-chapters-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-chapters:before, .video-js .vjs-chapters-button .vjs-icon-placeholder:before {
  content: "\f10e";
}

.vjs-icon-share {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-share:before {
  content: "\f10f";
}

.vjs-icon-cog, .vjs-setting-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-cog:before, .vjs-setting-button .vjs-icon-placeholder:before {
  content: "\f110";
}

.vjs-icon-circle, .video-js .vjs-play-progress,
.video-js .vjs-volume-level {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-circle:before, .video-js .vjs-play-progress:before,
.video-js .vjs-volume-level:before {
  content: "\f111";
}

.vjs-icon-circle-outline {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-circle-outline:before {
  content: "\f112";
}

.vjs-icon-circle-inner-circle {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-circle-inner-circle:before {
  content: "\f113";
}

.vjs-icon-hd {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-hd:before {
  content: "\f114";
}

.vjs-icon-cancel, .video-js .vjs-control.vjs-close-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-cancel:before, .video-js .vjs-control.vjs-close-button .vjs-icon-placeholder:before {
  content: "\f115";
}

.vjs-icon-replay, .video-js .vjs-play-control.vjs-ended .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-replay:before, .video-js .vjs-play-control.vjs-ended .vjs-icon-placeholder:before {
  content: "\f116";
}

.vjs-icon-facebook {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-facebook:before {
  content: "\f117";
}

.vjs-icon-gplus {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-gplus:before {
  content: "\f118";
}

.vjs-icon-linkedin {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-linkedin:before {
  content: "\f119";
}

.vjs-icon-twitter {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-twitter:before {
  content: "\f11a";
}

.vjs-icon-tumblr {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-tumblr:before {
  content: "\f11b";
}

.vjs-icon-pinterest {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-pinterest:before {
  content: "\f11c";
}

.vjs-icon-audio-description, .video-js .vjs-descriptions-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-audio-description:before, .video-js .vjs-descriptions-button .vjs-icon-placeholder:before {
  content: "\f11d";
}

.vjs-icon-audio, .video-js .vjs-audio-button .vjs-icon-placeholder {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-audio:before, .video-js .vjs-audio-button .vjs-icon-placeholder:before {
  content: "\f11e";
}

.vjs-icon-googlecast {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-googlecast:before {
  content: "\f11f";
}

.vjs-icon-googlecast-0 {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-googlecast-0:before {
  content: "\f120";
}

.vjs-icon-googlecast-1 {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-googlecast-1:before {
  content: "\f121";
}

.vjs-icon-googlecast-2 {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-googlecast-2:before {
  content: "\f122";
}

.vjs-icon-googlecast-connected {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-googlecast-connected:before {
  content: "\f123";
}

.vjs-icon-airplay {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-airplay:before {
  content: "\f124";
}

.vjs-icon-warning {
  font-family: VideoJS;
  font-weight: normal;
  font-style: normal;
}
.vjs-icon-warning:before {
  content: "\f126";
}

/*
======================================================================================================================================
// fonts.scss
======================================================================================================================================
*/
.video-js .vjs-mute-control .vjs-icon-placeholder:before {
  font-size: 0.95em;
  transform: translateY(0.05em);
  display: block;
}

.vjs-setting-button .vjs-icon-placeholder:before {
  font-size: 0.8em;
  transform: translateY(-0.005em);
  display: block;
}

.vjs-icon-github:before {
  font-size: 0.8em;
  padding: 0 0.2em;
  display: block;
}

/*
======================================================================================================================================
// menu.scss
======================================================================================================================================
*/
.vjs-menu .vjs-menu-content {
  padding: 0.3em 0;
  margin: 0;
  font-size: 0.875em;
  color: #fff;
}
.vjs-menu .vjs-menu-content .vjs-menu-item .vjs-menu-item-text {
  display: inline-block;
}
.vjs-menu .vjs-menu-content .vjs-menu-item.vjs-checkbox.vjs-selected:after {
  content: "";
  width: 0.4em;
  height: 0.8em;
  display: block;
  margin-top: -0.2em;
  border-right: 0.15em solid;
  border-bottom: 0.15em solid;
  transform: rotate(45deg);
}

.vjs-workinghover .vjs-menu-item:hover,
.vjs-workinghover .vjs-selected {
  background-color: rgba(255, 255, 255, 0.1);
}

.vjs-menu {
  display: none;
  position: absolute;
  bottom: 45px;
  left: -5em;
  box-shadow: 2px 2px 10px rgba(0, 0, 0, 0.7);
  background-color: rgba(28, 28, 28, 0.9);
  text-shadow: 0 0 2px rgba(0, 0, 0, 0.5);
}
.vjs-menu.vjs-lock-showing {
  display: block !important;
  opacity: 1;
  visibility: visible;
}

.vjs-menu li {
  list-style: none;
  margin: 0;
  padding: 0.7em 1em;
  line-height: 1.35em;
  font-size: 1em;
  text-align: left;
  outline: none;
  cursor: pointer;
  white-space: nowrap;
}
.vjs-menu li .vjs-icon-placeholder {
  font-size: 1.5em;
}

/*
======================================================================================================================================
// videojs.scss
======================================================================================================================================
*/
.video-js:-moz-full-screen {
  position: absolute;
}

.video-js:-webkit-full-screen {
  width: 100% !important;
  height: 100% !important;
}

.video-js[tabindex="-1"] {
  outline: none;
}

.video-js ul {
  font-family: inherit;
  font-size: inherit;
  line-height: inherit;
  list-style-position: outside;
  margin-left: 0;
  margin-right: 0;
  margin-top: 0;
  margin-bottom: 0;
  padding: 0;
  outline: 0;
}

.video-js.vjs-fluid,
.video-js.vjs-16-9,
.video-js.vjs-4-3 {
  width: 100%;
  max-width: 100%;
  height: 0;
}

.video-js.vjs-16-9 {
  padding-top: 56.25%;
}

.video-js.vjs-4-3 {
  padding-top: 75%;
}

.video-js.vjs-fill {
  width: 100%;
  height: 100%;
}

.video-js .vjs-tech {
  position: absolute;
  top: 0;
  left: 0;
  width: 100%;
  height: 100%;
}

body.vjs-full-window {
  padding: 0;
  margin: 0;
  height: 100%;
  overflow-y: auto;
}

.vjs-full-window .video-js.vjs-fullscreen {
  position: fixed;
  overflow: hidden;
  z-index: 1000;
  left: 0;
  top: 0;
  bottom: 0;
  right: 0;
}

.video-js.vjs-fullscreen {
  width: 100% !important;
  height: 100% !important;
  padding-top: 0 !important;
  background-color: #000;
}

.video-js.vjs-fullscreen.vjs-user-inactive {
  cursor: none;
}

.vjs-hidden {
  display: none !important;
}

.vjs-disabled {
  opacity: 0.5;
  cursor: default;
}

.video-js .vjs-offscreen {
  height: 1px;
  left: -9999px;
  position: absolute;
  top: 0;
  width: 1px;
}

.video-js .vjs-control-text {
  border: 0;
  clip: rect(0 0 0 0);
  height: 1px;
  overflow: hidden;
  padding: 0;
  position: absolute;
  width: 1px;
}

.vjs-controls-disabled .vjs-big-play-button,
.vjs-has-started .vjs-big-play-button,
.vjs-using-native-controls .vjs-big-play-button,
.vjs-error .vjs-big-play-button {
  display: none;
}

.vjs-has-started.vjs-paused.vjs-show-big-play-button-on-pause .vjs-big-play-button {
  display: block;
}

.vjs-resize-manager {
  position: absolute;
  top: 0;
  left: 0;
  width: 100%;
  height: 100%;
  border: none;
  visibility: hidden;
  z-index: -1;
}

.vjs-spacer {
  flex-grow: 1;
}

/*
======================================================================================================================================
// LoadingSpinner.scss
======================================================================================================================================
*/
.vjs-loading-spinner {
  display: none;
  width: 50px;
  height: 50px;
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  right: 0;
  margin: auto;
  text-align: left;
  box-sizing: border-box;
  background-clip: padding-box;
  border-radius: 50%;
}
.vjs-loading-spinner:after {
  content: "";
  display: block;
  width: 100%;
  height: 100%;
  border-width: 4px;
  border-style: solid;
  border-color: rgba(255, 255, 255, 0.5);
  border-top-color: white;
  border-radius: 50%;
  position: relative;
  top: 50%;
  margin: auto;
  margin-top: -50%;
}

.vjs-seeking .vjs-loading-spinner,
.vjs-waiting .vjs-loading-spinner {
  display: block;
  animation: h5LoadingAnimation 1s linear infinite;
}

@keyframes h5LoadingAnimation {
  0% {
    transform: rotate(0);
  }
  100% {
    transform: rotate(360deg);
  }
}
/*
======================================================================================================================================
// modal.scss
======================================================================================================================================
*/
.vjs-modal-dialog {
  position: absolute;
  top: 0;
  left: 0;
  width: 100%;
  height: 100%;
  display: table;
  outline: none;
  background-color: #000;
  color: #fff;
  opacity: 0.85;
}
.vjs-modal-dialog.vjs-text-track-settings {
  height: 80%;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-colors,
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-font {
  display: flex;
  flex-flow: wrap;
  flex-direction: column;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-colors fieldset,
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-font fieldset {
  padding: 0.35em 0.625em 0.75em;
  margin: 0 2px;
  border: 1px solid silver;
  font-size: 12px;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-colors fieldset legend,
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-font fieldset legend {
  margin-bottom: 0;
  width: auto;
  border-bottom: 0;
  font-size: 16px;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-colors .vjs-track-setting,
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-font .vjs-track-setting {
  margin-bottom: 5px;
  width: 100%;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-colors .vjs-track-setting select,
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-font .vjs-track-setting select {
  height: auto !important;
  padding: 2px !important;
  margin: 0 10px;
  color: #000;
  border-radius: 1px;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-track-settings-controls button {
  color: #000;
  margin-right: 5px;
  font-size: 13px;
}
.vjs-modal-dialog.vjs-text-track-settings .vjs-close-button {
  background: transparent;
  border: none;
}
.vjs-modal-dialog .vjs-modal-dialog-content {
  display: table-cell;
  vertical-align: middle;
  font-size: 1em;
  padding: 0 5em;
}

/*
======================================================================================================================================
// error.scss
======================================================================================================================================
*/
.vjs-error-display .vjs-modal-dialog-content {
  text-align: center;
}
.vjs-error-display .vjs-modal-dialog-content:before {
  font-size: 4em;
  line-height: 1em;
  margin-bottom: 0.2em;
  display: block;
}

/*
======================================================================================================================================
// player.scss
======================================================================================================================================
*/
.video-js {
  width: 100% !important;
  height: 100% !important;
  min-height: 200px;
  background-color: #000;
  -webkit-user-select: none;
          user-select: none;
  font-size: 16px;
  /* 
  *   hide ios big play button 
  *   https://stackoverflow.com/questions/8911247/hide-iphone-html5-video-play-button 
  */
  /**::-webkit-media-controls-panel,
  *::-webkit-media-controls-play-button,
  *::-webkit-media-controls-start-playback-button {
      display: none !important;
      -webkit-appearance: none;
  }*/
}
.video-js *,
.video-js *:before,
.video-js *:after {
  box-sizing: border-box;
}
.video-js > video {
  display: block;
}

/*
======================================================================================================================================
// progress.scss
======================================================================================================================================
*/
.vjs-progress-control {
  position: absolute !important;
  left: 0;
  right: 0;
  bottom: calc(2.5em - 0.32em);
  margin: auto;
  width: calc(100% - 1.5em);
  cursor: pointer;
}
.vjs-progress-control .vjs-progress-holder {
  position: relative;
  width: 100%;
  height: 0.96em;
  outline: 0;
}
.vjs-progress-control .vjs-progress-holder:before,
.vjs-progress-control .vjs-progress-holder > div {
  position: absolute;
  height: 0.2em;
  margin: 0.32em auto;
}
.vjs-progress-control .vjs-progress-holder:before {
  content: "";
  display: block;
  width: 100%;
  background-color: rgba(255, 255, 255, 0.4);
}
.vjs-progress-control .vjs-progress-holder .vjs-load-progress {
  background-color: rgba(255, 255, 255, 0.6);
}
.vjs-progress-control .vjs-progress-holder .vjs-play-progress {
  background-color: rgb(255, 255, 255);
}
.vjs-progress-control .vjs-progress-holder .vjs-play-progress:before {
  font-size: 0.96em;
  position: absolute;
  top: -0.32em;
  right: -0.48em;
  z-index: 1;
  line-height: 1em;
  opacity: 0;
}
.vjs-progress-control .vjs-time-tooltip {
  display: none;
  font-size: 0.85em;
  line-height: 1em;
  padding: 0.5em 0.7em;
  background-color: rgba(0, 0, 0, 0.5);
  border-radius: 5px;
  position: absolute;
  top: -2.5em;
}

.vjs-workinghover .vjs-progress-control:hover .vjs-play-progress:before {
  opacity: 1;
}
.vjs-workinghover .vjs-progress-control:hover .vjs-progress-holder:before,
.vjs-workinghover .vjs-progress-control:hover .vjs-progress-holder > div {
  height: 0.32em;
}
.vjs-workinghover .vjs-progress-control:hover .vjs-mouse-display .vjs-time-tooltip {
  display: block;
}

.vjs-progress-control .vjs-sliding .vjs-play-progress:before {
  opacity: 1;
}
.vjs-progress-control .vjs-sliding.vjs-progress-holder:before,
.vjs-progress-control .vjs-sliding.vjs-progress-holder > div {
  height: 0.32em;
}

/*
======================================================================================================================================
// controlbar.scss
======================================================================================================================================
*/
.vjs-control-bar {
  display: flex;
  visibility: visible;
  opacity: 1;
  width: 100%;
  height: auto;
  position: absolute;
  bottom: 0;
  padding: 0 0.75em;
  transition: 0.3s ease opacity;
  background-image: linear-gradient(to bottom, rgba(23, 23, 23, 0) 0%, rgba(0, 0, 0, 0.4) 100%);
  padding-top: 10px;
}
.vjs-control-bar * {
  color: #fff;
}
.vjs-control-bar button {
  font-size: inherit;
}
.vjs-control-bar .vjs-control-separator {
  display: flex;
}
.vjs-control-bar .vjs-control-separator .vjs-volume-panel,
.vjs-control-bar .vjs-control-separator .vjs-volume-panel button,
.vjs-control-bar .vjs-control-separator > .vjs-button {
  text-align: center;
  min-width: 2.25em;
}
.vjs-control-bar .vjs-control-separator.middle .vjs-spacer {
  display: none;
}
.vjs-control-bar .vjs-control-separator.bottom {
  width: 100%;
  align-items: center;
}
.vjs-control-bar button {
  outline: none;
  border: 0;
  background-color: transparent;
  padding: 0;
  margin: 0;
  cursor: pointer;
}
.vjs-control-bar .vjs-icon-placeholder {
  font-size: 1.375em;
  line-height: 1.8em;
}

.vjs-user-inactive.vjs-playing:not(.vjs-keep-control-showing) .vjs-control-bar {
  visibility: hidden;
  opacity: 0;
}

.vjs-controls-disabled .vjs-control-bar {
  display: none;
}

.vjs-big-play-button {
  outline: none;
  display: none;
  position: absolute;
  top: 0;
  left: 0;
  right: 0;
  bottom: 0;
  margin: auto;
  font-size: 5em;
  line-height: 1em;
  height: 1em;
  width: 1em;
  padding: 0;
  border: 0;
  background-color: transparent;
  color: #fff;
  cursor: pointer;
  filter: drop-shadow(1px 1px 10px #333);
}

.vjs-time-control {
  font-size: 0.85em;
  line-height: 1.8em;
}
.vjs-time-control.vjs-time-divider {
  min-width: 1em;
  text-align: center;
}

.vjs-playback-rate {
  font-size: 0.85em;
  line-height: 1.8em;
}
.vjs-playback-rate .vjs-playback-rate-value {
  position: absolute;
}
.vjs-playback-rate .vjs-menu-button {
  text-align: center;
  min-width: 2.25em;
  min-height: 1.24em;
}
.vjs-playback-rate .vjs-menu {
  left: -1em;
  bottom: 32px;
}
.vjs-playback-rate:hover .vjs-menu {
  display: block;
}
.vjs-playback-rate:hover .vjs-control-text {
  display: none !important;
}

.vjs-workinghover .vjs-control.vjs-time-control .vjs-control-text {
  display: none;
}
.vjs-workinghover .vjs-control,
.vjs-workinghover .vjs-menu-button-popup {
  position: relative;
}
.vjs-workinghover .vjs-control > .vjs-control-text,
.vjs-workinghover .vjs-menu-button-popup > .vjs-control-text {
  width: auto;
  height: auto;
  display: table;
  clip: auto;
  overflow: visible;
  font-size: 0.875em;
  top: calc(-1.5em - 25px);
  visibility: hidden;
  opacity: 0;
  transition: 0.3s opacity;
  background: #000;
  padding: 7px 10px;
  white-space: nowrap;
  border-radius: 3px;
  box-shadow: 2px 2px 10px rgba(0, 0, 0, 0.7);
  background-color: rgba(28, 28, 28, 0.9);
  text-shadow: 0 0 2px rgba(0, 0, 0, 0.5);
}
.vjs-workinghover .vjs-control:hover > .vjs-control-text,
.vjs-workinghover .vjs-menu-button-popup:hover > .vjs-control-text {
  visibility: visible;
  opacity: 1;
}
.vjs-workinghover .vjs-control-separator > .vjs-control:not(:last-child):not(:first-child) .vjs-control-text,
.vjs-workinghover .vjs-control-separator > div > .vjs-control .vjs-control-text,
.vjs-workinghover .vjs-control-separator .vjs-menu-button-popup .vjs-control-text {
  margin-left: 50%;
  transform: translateX(-50%);
}
.vjs-workinghover .vjs-control-separator.middle > *:last-child .vjs-control-text {
  margin-left: 50%;
  transform: translateX(-50%);
}
.vjs-workinghover .vjs-control-separator.bottom > *:last-child:not(:first-child) .vjs-control-text {
  right: 0;
}
.vjs-workinghover.vjs-mobile-view .vjs-control-separator > *:first-child .vjs-control-text {
  left: 0;
  margin-left: auto;
  transform: none;
}

.video-js .vjs-volume-panel {
  transition: min-width 0.3s;
  margin-right: 5px;
}
.video-js .vjs-volume-panel .vjs-volume-control {
  opacity: 0;
  width: 1px;
  height: 2.5em;
  margin-left: -1px;
  transition: width 0.3s, opacity 0.3s;
}
.video-js .vjs-volume-panel:hover .vjs-volume-control, .video-js .vjs-volume-panel:active .vjs-volume-control, .video-js .vjs-volume-panel:focus .vjs-volume-control, .video-js .vjs-volume-panel .vjs-volume-control:hover, .video-js .vjs-volume-panel .vjs-volume-control:active, .video-js .vjs-volume-panel .vjs-mute-control:hover ~ .vjs-volume-control, .video-js .vjs-volume-panel .vjs-volume-control.vjs-slider-active {
  visibility: visible;
  opacity: 1;
  position: relative;
}
.video-js .vjs-volume-panel:hover .vjs-volume-control.vjs-volume-horizontal, .video-js .vjs-volume-panel:active .vjs-volume-control.vjs-volume-horizontal, .video-js .vjs-volume-panel:focus .vjs-volume-control.vjs-volume-horizontal, .video-js .vjs-volume-panel .vjs-volume-control:hover.vjs-volume-horizontal, .video-js .vjs-volume-panel .vjs-volume-control:active.vjs-volume-horizontal, .video-js .vjs-volume-panel .vjs-mute-control:hover ~ .vjs-volume-control.vjs-volume-horizontal, .video-js .vjs-volume-panel .vjs-volume-control.vjs-slider-active.vjs-volume-horizontal {
  width: 3em;
  margin-right: 10px;
}
.video-js .vjs-volume-panel.vjs-volume-panel-horizontal:hover, .video-js .vjs-volume-panel.vjs-volume-panel-horizontal:active, .video-js .vjs-volume-panel.vjs-volume-panel-horizontal.vjs-slider-active {
  min-width: calc(2.25em + 3em);
  margin-right: 0.3125em;
}
.video-js .vjs-volume-panel .vjs-mute-control,
.video-js .vjs-volume-panel .vjs-volume-control {
  float: left;
}
.video-js .vjs-volume-panel .vjs-volume-level {
  background: rgb(255, 255, 255);
  position: absolute;
  top: 0px;
  left: 0px;
  bottom: 0px;
  margin: auto;
  width: 100%;
  height: 0.1875em;
  text-align: right;
}
.video-js .vjs-volume-panel .vjs-volume-level:before {
  position: absolute;
  top: -0.64em;
  right: -0.40625em;
  font-size: 0.8125em;
}
.video-js .vjs-volume-panel .vjs-volume-bar {
  position: relative;
  height: 100%;
}
.video-js .vjs-volume-panel .vjs-volume-bar:before {
  content: "";
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  margin: auto;
  width: 100%;
  height: 0.1875em;
  background-color: rgba(255, 255, 255, 0.6);
}

/*
======================================================================================================================================
// title.scss
======================================================================================================================================
*/
.vjs-title {
  color: #fff;
  position: relative;
  padding: 0 15px 5px 15px;
  width: 100%;
  overflow: hidden;
  background-image: linear-gradient(to top, rgba(23, 23, 23, 0) 0, rgba(0, 0, 0, 0.4) 100%);
  visibility: visible;
  opacity: 1;
  transition: 0.3s ease opacity;
}
.vjs-title .vjs-title-field {
  width: 100%;
  height: 2.5em;
  line-height: 2.5em;
  overflow: hidden;
  text-overflow: ellipsis;
}

.vjs-user-inactive.vjs-playing .vjs-title {
  visibility: hidden;
  opacity: 0;
}

/*
======================================================================================================================================
// PlayToggleLayer.scss
======================================================================================================================================
*/
.vjs-play-toggle-layer {
  position: absolute;
  top: 0;
  left: 0;
  width: 100%;
  height: 100%;
  outline: none;
  cursor: pointer;
}

/*
======================================================================================================================================
// ContextMenu.scss
======================================================================================================================================
*/
.vjs-context-menu {
  z-index: 1000;
  border-radius: 3px;
}

.vjs-context-menu-item {
  display: flex;
  align-items: center;
}
.vjs-context-menu-item span {
  display: block;
}
.vjs-context-menu-item .vjs-menu-item-text {
  margin-left: 0.5em;
}
.vjs-context-menu-item:after {
  margin-right: 0;
  margin-left: auto;
}

@media (min-width: 481px) {
  .vjs-context-menu {
    position: absolute;
    top: 0;
    left: 0;
  }
  .vjs-context-menu .vjs-menu-content {
    width: 16.0714285714em;
  }
}
@media (max-width: 480px) {
  .vjs-context-menu {
    top: 0 !important;
    left: 0 !important;
    visibility: hidden;
    will-change: visibility;
  }
  .vjs-context-menu:not(.vjs-hidden) {
    visibility: visible;
  }
}
@media (max-width: 480px) and (max-width: 480px) {
  .vjs-context-menu {
    position: fixed;
    width: 100%;
    height: 100%;
    background: none;
    text-shadow: none;
    box-shadow: none;
    transition: visibility 0s linear 0.3s;
  }
  .vjs-context-menu .vjs-menu-content {
    bottom: 0;
    width: 100% !important;
    color: #333;
    background-color: #fff;
    transform: translateY(100%);
    transition: 0.3s transform ease, 0.3s height ease;
  }
  .vjs-context-menu .vjs-menu-item {
    width: 100% !important;
  }
  .vjs-context-menu:not(.vjs-hidden) {
    transition: visibility 0s linear 0s;
  }
  .vjs-context-menu:not(.vjs-hidden) .vjs-close-menu-layer {
    opacity: 1;
  }
  .vjs-context-menu:not(.vjs-hidden) .vjs-menu-content {
    transform: translateY(0);
  }
}
@media (max-width: 480px) {
  .vjs-context-menu.vjs-hidden {
    display: block !important;
    visibility: hidden;
  }
  .vjs-close-context-menu {
    position: absolute;
    width: 100%;
    height: 100%;
    background-color: rgba(0, 0, 0, 0.7);
    opacity: 0;
    transition: opacity 0.3s;
  }
}
/*
======================================================================================================================================
// Setting.scss
======================================================================================================================================
*/
.vjs-setting-button .vjs-icon-placeholder {
  display: block;
  transform: rotate(0deg);
  transition: 0.2s transform;
}
.vjs-setting-button[aria-expanded=true] .vjs-icon-placeholder {
  transform: rotate(30deg);
}

.vjs-setting-menu {
  visibility: hidden;
  will-change: visibility;
  border-radius: 3px;
}
.vjs-setting-menu.vjs-lock-showing {
  visibility: visible;
}
@media (max-width: 480px) {
  .vjs-setting-menu {
    position: fixed;
    width: 100%;
    height: 100%;
    background: none;
    text-shadow: none;
    box-shadow: none;
    transition: visibility 0s linear 0.3s;
  }
  .vjs-setting-menu .vjs-menu-content {
    bottom: 0;
    width: 100% !important;
    color: #333;
    background-color: #fff;
    transform: translateY(100%);
    transition: 0.3s transform ease, 0.3s height ease;
  }
  .vjs-setting-menu .vjs-menu-item {
    width: 100% !important;
  }
  .vjs-setting-menu.vjs-lock-showing {
    transition: visibility 0s linear 0s;
  }
  .vjs-setting-menu.vjs-lock-showing .vjs-close-menu-layer {
    opacity: 1;
  }
  .vjs-setting-menu.vjs-lock-showing .vjs-menu-content {
    transform: translateY(0);
  }
}
.vjs-setting-menu::-webkit-scrollbar {
  width: 0px;
  background: transparent;
}
.vjs-setting-menu .vjs-menu-content {
  will-change: transform, width, height;
  transition: 0.3s transform ease, 0.3s width ease, 0.3s height ease;
  overflow: hidden;
}
.vjs-setting-menu .vjs-menu-item {
  display: flex;
  align-items: center;
}

.vjs-menu.vjs-settings-sub-menu {
  bottom: 0;
  right: 0;
  overflow: hidden;
}
.vjs-menu.vjs-settings-sub-menu.vjs-hidden {
  visibility: hidden;
  display: block !important;
}

.vjs-setting-menu-item:after {
  content: "";
  width: 0.65em;
  height: 0.65em;
  display: inline-block;
  border-right: 0.15em solid;
  border-bottom: 0.15em solid;
  transform: rotate(-45deg);
}

.vjs-settings-sub-menu-item {
  width: 100%;
}
.vjs-settings-sub-menu-item > div {
  width: 1em;
  margin-right: 0.5em;
}
.vjs-settings-sub-menu-item > div:before {
  content: "";
  display: block;
  margin: auto;
}

.vjs-menu-item.vjs-settings-sub-menu-title {
  background-color: transparent !important;
  border-bottom: 1px solid rgba(255, 255, 255, 0.5);
  padding: 0.6em 1em;
}
.vjs-menu-item.vjs-settings-sub-menu-title:after {
  content: "Hi, i am padding";
  visibility: hidden;
  display: block;
  height: 6px;
  width: 0;
}
.vjs-menu-item.vjs-settings-sub-menu-title > div:before {
  width: 0.65em;
  height: 0.65em;
  border-left: 0.15em solid;
  border-bottom: 0.15em solid;
  transform: rotate(45deg);
}

.vjs-settings-sub-menu-option.vjs-selected > div:before {
  margin: auto;
  content: "";
  width: 0.425em;
  height: 0.85em;
  display: block;
  margin-top: -0.2em;
  border-right: 0.15em solid;
  border-bottom: 0.15em solid;
  transform: rotate(45deg);
}

.vjs-setting-onoff-item .vjs-onoff-button {
  width: 2.16em;
  height: 0.96em;
  float: right;
  background-color: #ddd;
  border-radius: 50px;
  position: relative;
}
.vjs-setting-onoff-item .vjs-onoff-button:before {
  content: "";
  border-radius: 50%;
  height: 0;
  width: 1.2em;
  height: 1.2em;
  display: block;
  box-shadow: 0px 1px 6px rgba(0, 0, 0, 0.5);
  background: #fff;
  position: absolute;
  top: -0.12em;
  transform: translateX(0px);
  transition: 0.3s transform ease;
}
.vjs-setting-onoff-item .vjs-cell {
  display: table-cell;
  vertical-align: middle;
}
.vjs-setting-onoff-item .vjs-menu-item-text {
  float: left;
}
.vjs-setting-onoff-item.vjs-active .vjs-onoff-button:before {
  transform: translateX(0.96em);
}

.vjs-menu .vjs-menu-content .vjs-menu-item.vjs-setting-onoff-item, .vjs-menu .vjs-menu-content .vjs-menu-item.vjs-setting-menu-item {
  width: 16.0714285714em;
}

@media (min-width: 481px) {
  .vjs-menu.vjs-setting-menu {
    right: 10px;
    bottom: calc(2.5em + 15px);
    z-index: 1;
    max-height: calc(90% - 2.5em);
    overflow-y: auto;
  }
  .vjs-menu.vjs-setting-menu .vjs-menu-item .vjs-icon-placeholder {
    display: none;
  }
  .vjs-settings-sub-menu-item {
    padding-right: 1.5em !important;
  }
  .vjs-menu-item.vjs-settings-sub-menu-title {
    margin-bottom: 0.3em;
  }
  .vjs-setting-menu-value {
    text-align: right;
    padding-right: 0.8em;
    font-size: 0.85em;
    opacity: 0.9;
    color: #eee;
  }
}
@media (max-width: 480px) {
  .vjs-setting-menu-ready.vjs-setting-menu {
    max-height: none;
    right: 0;
    bottom: 0;
    z-index: 1000;
  }
  .vjs-setting-menu-ready.vjs-setting-menu .vjs-menu-item .vjs-icon-placeholder {
    width: 1em;
    margin-right: 0.5em;
  }
  .vjs-setting-menu-ready .vjs-close-setting-menu {
    position: absolute;
    width: 100%;
    height: 100%;
    background-color: rgba(0, 0, 0, 0.7);
    opacity: 0;
    transition: opacity 0.3s;
  }
  .vjs-setting-menu-ready .vjs-setting-menu-value {
    padding-right: 0.8em;
  }
}
/*
======================================================================================================================================
// Subtitles.scss
======================================================================================================================================
*/
/* Control bar is hidden */
.vjs-user-inactive.vjs-playing:not(.vjs-keep-control-showing) .vjs-text-track-display div {
  margin-bottom: 0.5em !important;
}
.vjs-user-inactive.vjs-playing:not(.vjs-keep-control-showing) .vjs-text-track-display div > div {
  bottom: 0 !important;
}
.vjs-user-inactive.vjs-playing:not(.vjs-keep-control-showing) .vjs-text-track-display .vjs-iphone-below-11 video::-webkit-media-text-track-container {
  margin-top: 0px !important;
}

.vjs-text-track-display > div {
  margin: calc(2.5em) 1.5% !important;
}
.vjs-text-track-display > div > div {
  top: auto !important;
  bottom: 15px !important;
}

/*
======================================================================================================================================
// gkan.scss
======================================================================================================================================
*/
/*Custom Size*/
.main-preview-player {
  display: flex;
  flex-direction: row;
  justify-content: flex-start;
  align-items: flex-start;
  flex-wrap: wrap;
}
.main-preview-player.player-full .vjs-video-wrap {
  width: 100% !important;
}
.main-preview-player .vjs-video-wrap {
  width: 80%;
  word-wrap: normal;
  height: calc(100vh - 50px);
  position: relative;
}
.main-preview-player .vjs-video-wrap .vjs-tech {
  padding: 0 30px;
}
.main-preview-player .vjs-playlist {
  width: 20%;
  top: 0;
  bottom: 0;
  right: 0;
  overflow: auto;
}

/*Play List*/
.vjs-playlist {
  background: #393939;
  color: #f2f2f2;
  height: 100%;
  padding: 0;
  font-size: 14px;
  margin: 0;
  position: absolute;
  top: 0;
  bottom: 0;
  right: 0;
  /*Border*/
  border-left-color: #2c2c2c;
  border-left-style: solid;
  border-left-width: 1px;
}
.vjs-playlist .vjs-playlist-item-list {
  position: relative;
  margin: 0;
  padding: 0;
  list-style: none;
}
.vjs-playlist .vjs-playlist-item {
  position: relative;
  cursor: pointer;
  overflow: hidden;
  line-height: 20px;
  border-bottom: 1px solid #202020;
}
.vjs-playlist .vjs-playlist-item:hover {
  background-color: #535353;
}
.vjs-playlist .vjs-playlist-item cite {
  color: #FFF;
}
.vjs-playlist .vjs-playlist-duration {
  position: absolute;
  top: 0.5rem;
  left: 0.5rem;
  padding: 2px 4px 3px;
  margin-left: 2px;
  background-color: rgba(26, 26, 26, 0.8);
}
.vjs-playlist .vjs-playlist-title-container {
  bottom: 0;
  box-sizing: border-box;
  width: 100%;
  height: 45px !important;
}
.vjs-playlist .vjs-playlist-title-container p {
  padding-top: 2px !important;
  adding-left: 10px !important;
}
.vjs-playlist .vjs-playlist-title-container div:first-child {
  padding: 10px 12px;
}
.vjs-playlist .vjs-playlist-name {
  display: block;
  max-height: 2.5em;
  padding: 0;
  text-overflow: ellipsis;
  font-weight: 500;
  font-style: normal;
  overflow: hidden;
  white-space: nowrap;
  font-size: 13px;
}
.vjs-playlist .vjs-playlist-description {
  margin: 0;
  text-overflow: ellipsis;
  overflow: hidden;
  height: 42px;
  line-height: 21px;
  color: #aaa;
  font-size: 12px;
}
.vjs-playlist .vjs-selected {
  background-color: #202020;
}
.vjs-playlist .vjs-selected .vjs-playlist-duration {
  display: none;
}

.vjs-playlist-vertical {
  overflow-x: hidden;
  overflow-y: auto;
}

.vjs-mouse .vjs-playlist {
  font-size: 15px;
}
.vjs-mouse .vjs-playlist .vjs-playlist-description {
  height: 45px;
  line-height: 23px;
}
@media (min-width: 600px) {
  .vjs-mouse .vjs-playlist {
    font-size: 17px;
  }
  .vjs-mouse .vjs-playlist .vjs-playlist-description {
    height: 51px;
    line-height: 26px;
  }
  .vjs-mouse .vjs-playlist .vjs-playlist-name {
    line-height: 22px;
  }
}

.userway-s3-2 .vjs-text-track-display > div,
.userway-s3-3 .vjs-text-track-display > div {
  background-color: rgba(0, 0, 0, 0) !important;
}

.switch-checkbox {
  display: block;
  -webkit-user-select: none;
          user-select: none;
}
.switch-checkbox input[type=checkbox]:checked ~ .checkbox-custom-toogle {
  padding-right: 0;
  padding-left: 30px;
  box-shadow: inset 0 0 1px rgb(28, 186, 99), inset 0 0 40px #1cba63 !important;
}
.switch-checkbox input[type=checkbox] {
  display: none;
  vertical-align: middle;
}
.switch-checkbox span {
  vertical-align: top;
  padding-left: 10px;
}
.switch-checkbox .checkbox-custom-toogle {
  display: inline-block;
  cursor: pointer;
  padding-right: 20px;
  transition: all ease 0.2s;
  border-radius: 20px;
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5);
}
.switch-checkbox .checkbox-custom-toogle:before {
  display: block;
  content: "";
  width: 20px;
  height: 20px;
  border-radius: 20px;
  background: white;
  box-shadow: 0 1px 2px rgba(0, 0, 0, 0.5);
}
.switch-checkbox input[type=checkbox]:checked ~ .checkbox-custom-toogle {
  padding-right: 0;
  padding-left: 20px;
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px lightblue;
}
.switch-checkbox input[type=checkbox][disabled] ~ .checkbox-custom-toogle {
  background: #282d36;
  border-color: #282d36;
  color: #eee;
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px lightblue !important;
  cursor: not-allowed;
}
.switch-checkbox.checkbox-inline {
  position: relative;
  display: inline-block;
}

.switch-checkbox.floatleft {
  float: left;
  margin-right: 5px;
}

.switch-checkbox.default input[type=checkbox]:checked ~ i.checkbox-custom-toogle {
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px #fff;
}
.switch-checkbox.primary input[type=checkbox]:checked ~ i.checkbox-custom-toogle {
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px #0088cc;
}
.switch-checkbox.success input[type=checkbox]:checked ~ i.checkbox-custom-toogle {
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px #47a447;
}
.switch-checkbox.info input[type=checkbox]:checked ~ i.checkbox-custom-toogle {
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px #5bc0de;
}
.switch-checkbox.warning input[type=checkbox]:checked ~ i.checkbox-custom-toogle {
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px #ed9c28;
}
.switch-checkbox.danger input[type=checkbox]:checked ~ i.checkbox-custom-toogle {
  box-shadow: inset 0 0 1px rgba(0, 0, 0, 0.5), inset 0 0 40px #d2322d;
}

div.profiles-links a.active {
  border: 1px solid #2baab1 !important;
}

.panel:not(.panel-modal):not(.panel-sign):not(.note-editor) {
  border: 1px solid #cecece;
}

.panel .left-part {
  border-radius: 3px 0 0 3px !important;
}
.panel .panel-heading:not(.note-toolbar) {
  border-radius: 3px 3px 0 0;
  padding: 18px 15px !important;
}
.panel .panel-heading:not(.note-toolbar).panel-heading-survey {
  padding: 0px 0px !important;
}
.panel .panel-heading:not(.note-toolbar).clearfix {
  padding: 15px !important;
}
.panel .panel-heading:not(.note-toolbar).clearfix .panel-title {
  padding-top: 7px;
}
.panel .panel-body h5.panel-title {
  font-size: 1.5rem;
  font-weight: 500;
  color: #000011;
}
.panel .panel-body h5.panel-title + h6 {
  margin-top: 6px;
}
.panel .panel-footer {
  border-radius: 0 0 3px 3px !important;
}
.panel .headadmin-class {
  font-size: 18px;
  font-weight: 500;
  line-height: 20px;
}

.panel-group .panel .panel-heading {
  padding: 0 !important;
  border-radius: 3px !important;
}
.panel-group .panel .panel-heading a:hover, .panel-group .panel .panel-heading a:focus {
  text-decoration: none;
}
.panel-group .panel .panel-heading a[class^=icon-] {
  margin-right: 4px;
  position: relative;
  top: 1px;
}

html .panel-transparent > .panel-footer {
  background: none;
  padding-left: 0;
  padding-right: 0;
  border-top: 0;
}
html .panel-height-200 {
  height: 200px;
}

.validation-summary-errors.external-login ul {
  list-style: none;
  padding-left: 0;
}
.validation-summary-errors.external-login ul li {
  color: #5C8825 !important;
}

.modal-header-primary {
  color: #fff;
  border-bottom: 1px solid #eee;
  background-color: #0C5B81;
  border-top-left-radius: 5px;
  border-top-right-radius: 5px;
}

.modal-fit.dark .modal-header-black {
  color: #fff;
  border-bottom: 0px solid #eee;
  background-color: #1f1f1f;
  border-top-left-radius: 5px;
  border-top-right-radius: 5px;
}
.modal-fit.dark .modal-header-black i.text-white {
  color: #FFF !important;
}
.modal-fit.dark .modal-body-black {
  position: relative;
  padding: 15px;
  background-color: black;
}
.modal-fit.dark .modal-body-black .tab-content {
  border-radius: 0 0 4px 4px;
  box-shadow: 0 1px 5px 0 rgba(0, 0, 0, 0.04);
  background-color: #000;
  border-top-color: rgb(238, 238, 238);
  border-top-style: solid;
  border-top-width: 1px;
  border-top: 0;
  padding: 15px;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark {
  background-color: black;
  border: 0px solid transparent;
  color: #FFF;
  padding: 5px;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark .alert-content-ct {
  height: 6em;
  display: flex;
  align-items: center;
  border-top: 2px solid #1f1f1f;
  border-top-left-radius: 6px;
  border-left: 2px solid #1f1f1f;
  border-right: 2px solid #1f1f1f;
  border-top-right-radius: 6px;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark .alert-content-ct p {
  margin: 0 0 -20px;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark .alert-content-ct .initials-content {
  width: 50px;
  height: 50px;
  border-radius: 6px;
  margin-top: 20px;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark .alert-content-ct .btn {
  margin-top: 9px;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark .alert-content-lc {
  margin-top: -10px;
  border-bottom: 2px solid #1f1f1f;
  border-bottom-left-radius: 6px;
  border-bottom-right-radius: 6px;
  border-left: 2px solid #1f1f1f;
  border-right: 2px solid #1f1f1f;
}
.modal-fit.dark .modal-body-black .tab-content .alert-dark .alert-content-lc span {
  font-size: 8.5px;
}
.modal-fit.default .modal-header-black {
  color: black;
  border-bottom: 0px solid black;
  background-color: #bcbcbc;
  border-top-left-radius: 5px;
  border-top-right-radius: 5px;
}
.modal-fit.default .modal-header-black i.text-white {
  color: black !important;
}
.modal-fit.default .modal-body-black {
  position: relative;
  padding: 15px;
  background-color: #eeeeee;
}
.modal-fit.default .modal-body-black .tab-content {
  border-radius: 0 0 4px 4px;
  box-shadow: 0 1px 5px 0 rgba(0, 0, 0, 0.04);
  background-color: #eeeeee;
  border-top-color: rgb(238, 238, 238);
  border-top-style: solid;
  border-top-width: 1px;
  border-top: 0;
  padding: 15px;
  border: 0px solid transparent;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark {
  background-color: #eeeeee;
  border: 0px solid transparent;
  color: #0A0A0A;
  padding: 5px;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark .alert-content-ct {
  height: 6em;
  display: flex;
  align-items: center;
  border-top: 2px solid #bcbcbc;
  border-top-left-radius: 6px;
  border-left: 2px solid #bcbcbc;
  border-right: 2px solid #bcbcbc;
  border-top-right-radius: 6px;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark .alert-content-ct p {
  margin: 0 0 -20px;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark .alert-content-ct .initials-content {
  width: 50px;
  height: 50px;
  border-radius: 5px;
  margin-top: 20px;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark .alert-content-ct .btn {
  margin-top: 9px;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark .alert-content-lc {
  margin-top: -10px;
  border-bottom: 2px solid #bcbcbc;
  border-bottom-left-radius: 6px;
  border-bottom-right-radius: 6px;
  border-left: 2px solid #bcbcbc;
  border-right: 2px solid #bcbcbc;
}
.modal-fit.default .modal-body-black .tab-content .alert-dark .alert-content-lc span {
  font-size: 8.5px;
}
.modal-fit.default .modal-body-black .nav-tabs li.active a, .modal-fit.default .modal-body-black .nav-tabs li.active a:hover, .modal-fit.default .modal-body-black .nav-tabs li.active a:focus {
  color: black !important;
  border-bottom: 3px solid #21bf38;
  font-size: 14px;
}
.modal-fit.default .modal-body-black .nav-tabs li a, .modal-fit.default .modal-body-black .nav-tabs li a:hover, .modal-fit.default .modal-body-black .nav-tabs li a:focus {
  color: #535151 !important;
}
.modal-fit.contrast .modal-header-black {
  color: #FCFF3C;
  border-bottom: 0px solid black;
  background-color: #1f1f1f;
  border-top-left-radius: 5px;
  border-top-right-radius: 5px;
}
.modal-fit.contrast .modal-header-black i.text-white {
  color: #FCFF3C !important;
}
.modal-fit.contrast .modal-body-black {
  position: relative;
  padding: 15px;
  background-color: black;
}
.modal-fit.contrast .modal-body-black .tab-content {
  border-radius: 0 0 4px 4px;
  box-shadow: 0 1px 5px 0 rgba(0, 0, 0, 0.04);
  background-color: #1f1f1f;
  border-top-color: rgb(252, 255, 60);
  border-top-style: solid;
  border-top-width: 1px;
  border-top: 0;
  padding: 15px;
  border: 0px solid transparent;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark {
  background-color: #1f1f1f;
  border: 0px solid transparent;
  color: #FCFF3C;
  padding: 5px;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark .alert-content-ct {
  height: 6em;
  display: flex;
  align-items: center;
  border-top: 2px solid black;
  border-top-left-radius: 6px;
  border-left: 2px solid black;
  border-right: 2px solid black;
  border-top-right-radius: 6px;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark .alert-content-ct p {
  margin: 0 0 -20px;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark .alert-content-ct .initials-content {
  width: 50px;
  height: 50px;
  border-radius: 5px;
  margin-top: 20px;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark .alert-content-ct .btn {
  margin-top: 9px;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark .alert-content-lc {
  margin-top: -10px;
  border-bottom: 2px solid black;
  border-bottom-left-radius: 6px;
  border-bottom-right-radius: 6px;
  border-left: 2px solid black;
  border-right: 2px solid black;
}
.modal-fit.contrast .modal-body-black .tab-content .alert-dark .alert-content-lc span {
  font-size: 8.5px;
}
.modal-fit.contrast .modal-body-black .nav-tabs li.active a, .modal-fit.contrast .modal-body-black .nav-tabs li.active a:hover, .modal-fit.contrast .modal-body-black .nav-tabs li.active a:focus {
  color: #FCFF3C !important;
  border-bottom: 3px solid #21bf38;
  font-size: 14px;
}
.modal-fit.contrast .modal-body-black .nav-tabs li a, .modal-fit.contrast .modal-body-black .nav-tabs li a:hover, .modal-fit.contrast .modal-body-black .nav-tabs li a:focus {
  color: #535151 !important;
}
.modal-fit .custom-uib-accordion .panel-default.enabled-lti-tool .panel-heading {
  padding: 10px, 15px !important;
}

.panel-licensing-contents {
  display: flex;
  flex-wrap: wrap;
}
.panel-licensing-contents .include {
  width: 50%;
  height: fit-content;
  padding-right: 5px;
}
.panel-licensing-contents .exclude {
  width: 50%;
  height: fit-content;
}

.content-license-info .tab-content {
  padding: 0px !important;
}

.widget-dotted {
  border: 1px dotted #cecece;
  padding: 15px;
}

.home-skillify-widgets .panel-horizontal {
  cursor: pointer !important;
}
.home-skillify-widgets .panel-horizontal .panel-heading-icon.bg-primary {
  border-color: unset !important;
  background: unset !important;
  color: #777 !important;
}
.home-skillify-widgets .panel-horizontal h3 {
  font-size: 2rem !important;
}

.modal-block-info.modal-header-color .panel-heading {
  background-color: #0C5C82;
}
.modal-block-info.modal-header-color .panel-heading .fa {
  color: #FFF;
}
.modal-block-info.modal-full-color .panel {
  background-color: #0C5C82;
}
.modal-block-info.modal-full-color .panel-heading {
  background-color: #0C5C82;
}
.modal-block-info.modal-full-color .panel-footer {
  background-color: #0C5C82;
}

.modal-fit .panel-body {
  max-height: calc(70vh - 150px);
  overflow: auto;
}

.modal-test-assignment {
  width: 700px !important;
}

.modal-block .panel-body.max-height400 {
  max-height: 400px !important;
  overflow-y: auto;
}

.container-permissions {
  padding: 5px 0 !important;
}
.container-permissions .p-3 {
  padding: 3px !important;
}
.container-permissions .switch-permission {
  width: 70px;
  float: left;
}
.container-permissions .permission-name:not(.inmodal) {
  width: calc(100% - 70px);
  float: left;
}

.abp-modal-default {
  background-color: #0C5C82;
}
.abp-modal-default h2 {
  color: #FFF;
}

.modal-standart-background {
  background-color: #0C5C82;
  color: #FFF;
}
.modal-standart-background h2 {
  font-size: 20px !important;
  line-height: 20px;
  padding: 0;
}

.settings-readonly {
  display: flex;
  align-items: center;
  font-size: 12px;
  font-weight: 500;
  margin-top: 10px;
}
.settings-readonly .setting {
  margin-right: 5px;
}

.manage-settings-test {
  display: flex;
  flex-wrap: wrap;
}
.manage-settings-test .help {
  margin-left: 5px;
  vertical-align: text-top;
}
.manage-settings-test .form-inline {
  display: flex;
  width: 100%;
}
.manage-settings-test .spinner-inline {
  display: flex;
  width: 100%;
}
.manage-settings-test .spinner-inline .input-group {
  width: 100%;
}
.manage-settings-test .spinner-inline .input-group input {
  width: 70px !important;
}

#floating-filters {
  background: #171717;
  bottom: 0;
  min-height: 100vh;
  position: absolute;
  right: 0;
  top: 0;
  width: 300px;
}

/* Sign Screens - Elements */
.body-sign .panel-sign .panel-body {
  border-radius: 5px 5px 5px 5px;
}

html.sidebar-right-opened .content-test {
  margin-left: 300px !important;
}

/*Fixed Timer Styles*/
.timer-test .hours:after,
.timer-test .minutes:after,
.timer-test .seconds:not(.text-weight-bold):after {
  content: ":";
  padding-left: 5px;
}

/*Clase general para el test player*/
html.test-player-alone {
  overflow-y: hidden !important;
}
html.test-player-alone .test-container {
  overflow: auto;
  margin: 0 !important;
  padding: 20px 50px;
}
html.test-player-alone .scrolling-tabs-wrapper > .scrollable-tabs {
  margin-bottom: 80px !important;
}
html.test-player-alone .content-test > .content {
  margin-bottom: 120px;
}

.take-test {
  padding-top: 0 !important;
  transition: margin 0.2s ease !important;
  overflow: visible;
}
.take-test .sidebar-right {
  background: #fff !important;
  border-left: 1px solid #cecece !important;
  transition: all 0.4s ease !important;
}
@media (max-width: 767px) {
  .take-test .sidebar-right {
    top: 50px;
    padding: 0 0 0 30px;
  }
}
.take-test .sidebar-right .sidebar-widget.widget-friends ul li {
  padding: 5px 0 !important;
}
.take-test .sidebar-right .sidebar-widget.widget-friends ul li .profile-info {
  margin: 0 10px;
  width: 75%;
}
.take-test .sidebar-right .sidebar-widget.widget-friends ul li .profile-info .name {
  text-overflow: ellipsis;
  white-space: nowrap;
  margin: 0;
  font-weight: 500;
}
.take-test .content-test {
  margin: 0 auto;
}
.take-test .content-test .test-runner-simple {
  display: flex;
  width: 80%;
  margin: 10px auto 125px;
  background: #fff;
  box-shadow: 0 0 20px 0 rgba(0, 0, 0, 0.2), 0 5px 5px 0 rgba(0, 0, 0, 0.24);
}
.take-test .content-test .test-runner-simple .panel-title p {
  margin-bottom: 0;
}
.take-test .content-body {
  padding: 0;
  margin-left: 0 !important;
}
.take-test .content-body .panel-questions .panel-navigation {
  background: transparent;
  border: 0;
  border-bottom: 1px solid #cecece;
  margin-bottom: 0;
  box-shadow: none;
  border-radius: 0;
}
.take-test .content-body .section-padding {
  padding-top: 0 !important;
  padding-bottom: 0 !important;
}
.take-test .content-body .page-header {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
  flex-wrap: wrap;
  left: 0px;
  margin: 0;
  position: fixed;
  right: 0;
  top: 0px;
  box-shadow: none !important;
  transition: all 0.4s ease;
  background: #23262b !important;
  color: #FFF !important;
}
.take-test .content-body .page-header .visible-small {
  display: none;
}
.take-test .content-body .page-header .breadcrumbs {
  display: flex !important;
  flex-direction: row;
  margin-top: -3px;
}
.take-test .content-body .page-header .breadcrumbs li {
  padding: 0px 10px;
}
.take-test .content-body .page-header .breadcrumbs li a {
  line-height: inherit !important;
}
.take-test .content-body .page-header .breadcrumbs .accessibility-dropdown-menu span {
  color: #777 !important;
}
.take-test .content-body .page-header .page-header-title {
  display: inline-block;
  padding: 0 10px;
  margin: 13px 0;
  min-width: 1px;
  font-weight: 600;
  color: #23262b;
}
.take-test .content-body .page-header a {
  font-style: normal !important;
  align-items: center;
  justify-content: center;
  width: 100%;
  height: 100%;
}
.take-test .content-body .page-header a .far {
  font-size: 2rem;
}
.take-test .content-body .page-header a .fas,
.take-test .content-body .page-header a .text-progress {
  height: 1em;
  margin: 0 auto 5px;
  text-align: center;
}
.take-test .content-body .page-header a,
.take-test .content-body .page-header h2,
.take-test .content-body .page-header span,
.take-test .content-body .page-header .page-header-title {
  color: #FFF !important;
}
.take-test .content-body .page-header a:hover {
  color: #3d9de1 !important;
}
.take-test .content-body .page-header i:hover {
  color: #3d9de1 !important;
}
.take-test .content-body .page-header h2 {
  padding: 10px 20px 10px 15px;
}
.take-test .content-body .page-header a.white-hover:hover {
  color: #23262b !important;
}
.take-test .content-body .page-header i.white-hover:hover {
  color: #23262b !important;
}
.take-test .test-container {
  margin: 10px !important;
}
.take-test .test-container .content-test {
  padding-top: 0;
  height: 85vh;
}
.take-test .test-container .content-test span.zoom-text {
  font-size: 12px;
  overflow: auto;
}
.take-test .test-container .tab-pane .panel-body:not(.panel-body-testhome) {
  background: #fff;
  box-shadow: none !important;
  border-radius: 0 !important;
}
.take-test .test-container .test-information {
  font-size: 14px !important;
}
.take-test .test-container .test-information li {
  text-align: left;
  margin: 10px;
  margin-left: 0px !important;
}
.take-test .test-container .test-information p {
  text-align: left;
}
.take-test .test-container .tab-pane {
  min-width: 150px !important;
}
.take-test .show-answers-summary {
  min-height: 50px !important;
}
.take-test .home-container {
  padding-top: 6%;
}

@media only screen and (max-width: 768px) {
  .take-test .content-body .page-header {
    height: 100px;
    padding-right: 0px;
  }
  .take-test .content-body .page-header .container-title {
    width: calc(100vw - 60px) !important;
  }
  .take-test .content-body .page-header .container-title .page-header-title {
    width: calc(100vw - 60px) !important;
    max-height: 34px;
    overflow: hidden;
    white-space: nowrap;
    text-overflow: ellipsis;
  }
  .take-test .content-body .page-header .breadcrumbs {
    justify-content: center;
    width: 100%;
    margin-right: 0px;
    border-top: 1px solid #cecece;
  }
  .take-test .content-body .test-container {
    padding-top: 120px;
  }
}
@media only screen and (min-width: 769px) and (max-width: 1024px) {
  .take-test .content-body .page-header {
    height: 100px;
    padding-right: 0px;
  }
  .take-test .content-body .page-header .container-title {
    width: calc(100vw - 60px) !important;
  }
  .take-test .content-body .page-header .container-title .page-header-title {
    width: calc(100vw - 60px) !important;
    max-height: 34px;
    overflow: hidden;
    white-space: nowrap;
    text-overflow: ellipsis;
  }
  .take-test .content-body .page-header .breadcrumbs {
    justify-content: center;
    width: 100%;
    margin-right: 0px;
    border-top: 1px solid #cecece;
  }
  .take-test .content-body .test-container {
    padding-top: 120px;
  }
}
.test-scale-Grade .l-between {
  width: auto;
  float: left;
  padding-right: 5px;
  padding-top: 5px;
}
.test-scale-Grade .scale-scoring {
  width: 73px;
  float: left;
}
.test-scale-Grade .l-and {
  width: auto;
  float: left;
  padding-right: 5px;
  padding-left: 5px;
  padding-top: 5px;
}
.test-scale-Grade .l-label {
  padding-left: 5px;
  float: none;
}

.valuetimedtest label {
  width: auto;
  float: left;
  padding: 5px 5px 5px 0;
}
.valuetimedtest input {
  width: 50px;
}

.hours:not(.uib-increment, .uib-decrement, .uib-time):after,
.minutes:not(.uib-increment, .uib-decrement, .uib-time):after,
.seconds:not(.uib-increment, .uib-decrement, .uib-time, .text-weight-bold):after {
  content: ":";
  padding-left: 5px;
}

.zoom-text {
  font-size: 12px;
  overflow: auto;
}

.zoom-text-wscrool {
  font-size: 12px;
  overflow: visible;
}

.dragging-container {
  border-color: black;
  border-width: thin;
  border-style: dotted;
  padding: 5px 8px;
}

.settings-custom-values {
  display: flex;
  align-items: center;
}
.settings-custom-values input {
  width: 70px;
  padding-right: 3px;
}

/*Test feedback with user way ussies*/
.actions-feeedback-answer {
  display: flex;
  justify-content: space-between;
}
.actions-feeedback-answer .btn-feedback {
  width: 32%;
  display: flex;
  align-items: center;
}
.actions-feeedback-answer .btn-feedback.aling-left {
  justify-content: flex-start;
}
.actions-feeedback-answer .btn-feedback.aling-center {
  justify-content: center;
}
.actions-feeedback-answer .btn-feedback.aling-rigth {
  justify-content: flex-end;
}
.actions-feeedback-answer .btn-feedback button {
  padding: 6px 12px !important;
  border-radius: 10px;
  box-shadow: 0px 8px 15px rgba(0, 0, 0, 0.1);
  transition: all 0.3s ease 0s;
  cursor: pointer;
  outline: none;
}

.container-actions-feedback {
  display: flex;
  flex-wrap: wrap;
}

@media (min-width: 576px) {
  .container-actions-feedback .answer-status-message, .container-actions-feedback .actions-feeedback-answer {
    width: 100%;
  }
}
@media (min-width: 768px) {
  .container-actions-feedback .answer-status-message, .container-actions-feedback .actions-feeedback-answer {
    width: 50%;
  }
}
.container-insert-proctor-code {
  width: 100%;
  display: flex;
  justify-content: space-between;
  align-items: center;
}
.container-insert-proctor-code .insert-proctor-code {
  width: 25px;
  padding: 5px;
  text-align: center;
}

.test-container {
  background-color: #fff !important;
}
.test-container link:hover {
  color: #0088CC !important;
}
.test-container li a:hover {
  color: #0088CC !important;
}

body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-heading,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-heading {
  background: #f8f8f8 !important;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-heading .zoom-text,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-heading .zoom-text {
  color: #000000;
  text-align: center;
  font-size: 18px;
  font-weight: 600;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-heading.drag-to-paragraph .panel-featured,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-heading.drag-to-paragraph .panel-featured {
  border-color: #15A2EE !important;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-heading.drag-to-paragraph .panel-featured .zoom-text,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-heading.drag-to-paragraph .panel-featured .zoom-text {
  color: #000000;
  text-align: center;
  font-size: 18px;
  font-weight: 600;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .questions-take .input-group-answers,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .questions-take .input-group-answers {
  background: #EAECEE;
  border-radius: 4px;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .questions-take .input-group-answers label,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .questions-take .input-group-answers label {
  color: #000000;
  font-size: 14px;
  font-weight: 500;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .drag-container .panel-featured,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .drag-container .panel-featured {
  color: #000000;
  font-size: 14px;
  background: #EAECEE;
  font-weight: 500;
  border-color: #15A2EE !important;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .drag-container .panel-featured span,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .drag-container .panel-featured span {
  font-size: 14px;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .input-group .input-group-addon,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .input-group .input-group-addon {
  color: #000000;
  font-size: 14px;
  background: #EAECEE;
  font-weight: 500;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .list-answers.ui-droppable, body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .list-options.ui-droppable,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .list-answers.ui-droppable,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .list-options.ui-droppable {
  background: #EAECEE;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .list-answers.ui-droppable .btn-draggable, body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .list-options.ui-droppable .btn-draggable,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .list-answers.ui-droppable .btn-draggable,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .list-options.ui-droppable .btn-draggable {
  font-weight: 500;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .list-answers.ui-droppable .btn-draggable p, body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .list-options.ui-droppable .btn-draggable p,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .list-answers.ui-droppable .btn-draggable p,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .list-options.ui-droppable .btn-draggable p {
  color: #000000;
  font-size: 14px;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .drag-matching li,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .drag-matching li {
  background: #EAECEE;
}
body.student-panel.body-coding-in-minecraft .container-take-test .panel-questions .panel-body .drag-matching li p,
body.student-panel.body-coding-in-minecraft .test-runner-course .panel-questions .panel-body .drag-matching li p {
  color: #000000;
  font-size: 14px;
  font-weight: 500;
}

/*Tabs (move to tabs.scss file)*/
/*Colors for content ligth*/
.no-border-bottom {
  border-bottom: none !important;
}

.nav-tabs li a {
  border-radius: 0;
  margin-right: 0;
  background: transparent;
}
.nav-tabs li a, .nav-tabs li a:hover {
  background: transparent;
  border-top: none;
  border-left: 0;
  border-right: 0;
  color: #999;
}
.nav-tabs li a:hover {
  color: #555;
  border-bottom: 3px solid #555;
}
.nav-tabs li.active a,
.nav-tabs li.active a:hover,
.nav-tabs li.active a:focus {
  color: #555;
  font-weight: 400;
  border-top: 0;
  background: transparent;
  border-left: 0;
  border-right: 0;
  border-bottom: 3px solid #555;
}
.nav-tabs.tabs-vertical li a.active a,
.nav-tabs.tabs-vertical li a.active a:hover,
.nav-tabs.tabs-vertical li a.active a:focus {
  border-bottom: 0px !important;
}

.tabs-vertical li a:hover {
  border-top: none;
  border-bottom: none;
}
.tabs-vertical li.active a,
.tabs-vertical li.active a:hover,
.tabs-vertical li.active a:focus {
  border-right: 1px solid #EEE;
  border-left: 3px solid #EEE;
  border-bottom: 0px !important;
}

.tab-content.tab-courses {
  padding: 15px;
  border-radius: 4px;
  min-height: 768px;
}
.tab-content .tab-content-no-border {
  border-left: 0;
  border-right: 0;
  border-bottom: 0;
  box-shadow: none;
}

/*Create Courses*/
.content-curriculum {
  margin: -16px -15px 0 -15px;
}
.content-curriculum .alert-dark {
  border-radius: 4px !important;
  margin-bottom: 0;
}
.content-curriculum .section-button {
  margin: 20px 0;
}
.content-curriculum .section-block:first-child .section-header {
  border-radius: 4px 4px 0 0;
  margin-top: -1px;
}
.content-curriculum .section-block:not(:first-child) {
  border-top: 1px solid #FFF;
}
.content-curriculum .section-block .section-header {
  justify-content: unset;
  align-items: baseline;
  padding: 10px 20px;
  background: #3d9de1;
}
.content-curriculum .section-block .section-header,
.content-curriculum .section-block .section-header a {
  color: #FFF;
}
.content-curriculum .section-block .section-header.hvr:hover .section-actions {
  display: block;
}
.content-curriculum .section-block .section-header .section-description {
  font-size: 16px;
  line-height: 1.36;
  text-align: left;
  font-weight: 300;
  padding-left: 10px;
}
.content-curriculum .section-block .section-header .section-description:empty {
  padding: 0;
}
.content-curriculum .section-block .section-header .section-content-name {
  margin-bottom: 0;
  font-size: 16px;
  line-height: 22px;
  font-weight: 400;
  display: flex;
}
.content-curriculum .section-block .section-header .section-content-name .section-name {
  text-decoration: none;
  flex-grow: 1;
  font-size: 24px;
  font-weight: 400;
  line-height: 1.17;
  position: relative;
  margin-left: 10px;
}
.content-curriculum .section-block .section-header .section-content-name .section-name:before {
  font-family: "Font Awesome 5 Pro";
  content: "\f0de";
  width: 26px;
  height: 26px;
  display: block;
  position: absolute;
  left: -25px;
  top: 0;
  text-align: center;
  font-size: 26px;
  color: #fff;
  margin-top: 5px;
  font-weight: 900;
}
.content-curriculum .section-block .section-header .section-content-name .section-name.collapsed:before {
  margin-top: -5px;
  content: "\f0dd";
}
.content-curriculum .section-block .section-header .section-content-name .section-actions {
  display: none;
}
.content-curriculum .section-block .section-header .section-content-name .section-actions span {
  font-size: 14px;
  margin-right: 5px;
}
.content-curriculum .section-block .section-header .section-content-name .section-actions span:last-child {
  margin-right: 0;
}
.content-curriculum .section-block > div > ul {
  list-style: none;
  margin: 0 0 20px 0;
  padding: 0 20px;
}
.content-curriculum .section-block > div > ul > li {
  clear: both;
  margin: 0;
  box-shadow: none;
  border-width: 0 0 1px;
  overflow: unset;
  border-radius: 0;
  border-bottom: 1px solid #e5e5e5;
  margin-bottom: 5px;
}
.content-curriculum .section-block > div > ul > li.hvr {
  border-bottom: 1px dashed rgba(0, 0, 0, 0.3);
  transition: opacity 0.15s ease-in-out;
  border-bottom-color: rgba(0, 0, 0, 0.3);
}
.content-curriculum .section-block > div > ul > li.hvr > .section-actions:not(.options-open) .add-button-plus {
  display: block;
}
.content-curriculum .section-block > div > ul > li > .section-actions:not(.options-open) .add-button-plus {
  display: none;
}
.content-curriculum .section-block > div > ul > li:last-child {
  border-bottom: 1px solid transparent;
}
.content-curriculum .section-block > div > ul > li:last-child:hover {
  border-bottom: 1px dashed rgba(0, 0, 0, 0.3);
  transition: opacity 0.15s ease-in-out;
  border-bottom-color: rgba(0, 0, 0, 0.3);
}
.content-curriculum .section-block > div > ul > li .element-icon {
  font-size: 20px;
  margin-right: 15px;
}
.content-curriculum .section-block > div > ul > li ul:not(.uploads-tabs):not(.pagination):not(.dropdown-menu) {
  list-style: none;
  margin: -1px -30px;
  padding: 0 30px;
  border-top: 1px solid #e5e5e5;
  border-bottom: 1px solid #e5e5e5;
}
.content-curriculum .section-block > div > ul > li ul:not(.uploads-tabs):not(.pagination):not(.dropdown-menu) > li {
  clear: both;
  margin: 0;
  box-shadow: none;
  border-width: 0 0 1px;
  overflow: unset;
  border-radius: 0;
  border-bottom: 1px solid #e5e5e5;
}
.content-curriculum .section-block > div > ul > li ul:not(.uploads-tabs):not(.pagination):not(.dropdown-menu) > li:last-child {
  border-bottom: none;
}
.content-curriculum .section-block > div > ul > li ul:not(.uploads-tabs):not(.pagination):not(.dropdown-menu) > li .template-container {
  width: 100%;
}
.content-curriculum .section-block > div > ul > li ul:not(.uploads-tabs):not(.pagination):not(.dropdown-menu) > li:not(:last-child, .no-border-bottom) {
  border-bottom: 1px solid #e5e5e5 !important;
  border-top: 0;
}
.content-curriculum .section-block > div > ul .element-block {
  font-weight: 400;
  position: relative;
  font-size: 14px;
  line-height: 1.75;
  text-align: left;
  color: #2b3339;
  padding-left: 24px;
  padding-top: 12px;
  padding-bottom: 12px;
  border-bottom: 0;
  cursor: pointer;
}
.content-curriculum .section-block > div > ul .element-block.no-padding {
  padding-left: 0;
}
.content-curriculum .section-block > div > ul .element-block .element-flex {
  display: flex;
}
.content-curriculum .section-block > div > ul .element-block.hvr:hover .item-actions {
  display: block;
}
.content-curriculum .section-block > div > ul .element-block .element-content {
  display: flex;
  align-items: center;
  font-size: 15px;
  width: 100%;
}
.content-curriculum .section-block > div > ul .element-block .element-content,
.content-curriculum .section-block > div > ul .element-block .element-content a {
  color: #202121;
}
.content-curriculum .section-block > div > ul .element-block .element-content .item-name {
  flex-grow: 1;
  font-weight: 400;
  font-size: 20px;
  line-height: 1.56;
  text-align: left;
  font-style: normal;
  font-weight: 400;
  padding-top: 2px;
}
.content-curriculum .section-block > div > ul .element-block .element-content .item-actions {
  display: none;
}
.content-curriculum .section-block > div > ul .element-block .element-content .item-actions span {
  font-size: 14px;
  margin-right: 5px;
}
.content-curriculum .section-block > div > ul .element-block .element-content .item-actions span:last-child {
  margin-right: 0;
}
.content-curriculum .section-block > div > ul .element-block .element-details {
  font-size: 13px;
  font-weight: 400;
  opacity: 0.75;
}
.content-curriculum .section-block > div > ul .element-block .element-details .text-dark {
  color: #000 !important;
}
.content-curriculum .section-block > div > ul .element-block > :not(.instructor-resources) .element-details {
  display: inline-block;
}
.content-curriculum .section-block > div > ul .element-block .element-description {
  color: #202121;
  display: block;
  font-size: 14px;
  line-height: 1.36;
  text-align: left;
  font-weight: 300;
}

.section-block .add-container {
  display: block;
  position: relative;
  width: 100%;
}
.section-block .add-container.no-display {
  display: none;
}
.section-block .add-container.inline-block {
  display: inline-block;
  padding: 30px;
}
.section-block .add-container .add-content {
  width: 100%;
  position: relative;
}
.section-block .add-container .add-content .add-bar-position {
  position: absolute;
  top: -15px;
  left: 0;
  width: 100%;
  height: 30px;
  cursor: pointer;
  visibility: visible;
  transition: opacity 0.15s ease-in-out;
}
.section-block .add-container .add-content .add-bar-position .add-button-plus:hover {
  background: #101824;
  border-color: hsla(0, 0%, 100%, 0.3);
}
.section-block .add-container .add-content .add-bar-position .add-button-plus:hover:after, .section-block .add-container .add-content .add-bar-position .add-button-plus:hover:before {
  background: #fff;
}
.section-block .add-container .add-content .add-bar-position .add-button-plus:hover.button-content, .section-block .add-container .add-content .add-bar-position .add-button-plus:hover.button-section {
  color: #fff;
}
.section-block .add-container .add-content .add-bar-container {
  position: relative;
  top: 15px;
  width: 100%;
  display: block;
}
.section-block .add-container .add-content .add-bar-container .add-bar {
  display: block;
  width: 100%;
  position: relative;
}
.section-block .add-container .add-content .add-bar-container .border-left,
.section-block .add-container .add-content .add-bar-container .border-rigth {
  position: absolute;
  top: 50%;
  left: 0;
  width: calc(50% - 100px);
  height: 0;
  border-top: 1px dashed hsla(0, 0%, 100%, 0.3);
  border-bottom: 1px dashed rgba(0, 0, 0, 0.3);
  transition: opacity 0.15s ease-in-out;
  border-bottom-color: rgba(0, 0, 0, 0.3);
}
.section-block .add-container .add-content .add-bar-container .border-rigth {
  left: auto;
  right: 0;
}
.section-block .add-container .add-content .add-bar-container .add-button-position {
  position: absolute;
  top: -13px;
  left: calc(50% - 90px);
  margin-left: -10px;
  width: 200px;
  height: 28px;
}
.section-block .add-container .content-container {
  display: block;
  width: 100%;
  text-align: center;
  height: 0;
}
.section-block .add-container .content-container .content-files {
  display: inline-block;
  background: rgba(245, 249, 252, 0.25);
  overflow: hidden;
  visibility: hidden;
  width: 85%;
  height: 0;
  opacity: 0;
  filter: alpha(opacity=0);
  border-radius: 3px;
  transition: all 0.2s ease-in-out;
  box-shadow: 0 0 13px 0 rgba(22, 45, 61, 0.2);
}
.section-block .add-container .content-container .content-files .content-files-in {
  display: block;
  width: 100%;
  padding: 25px 19px 19px;
}
.section-block .add-container .content-container .content-files .content-files-list {
  display: block;
  width: 100%;
  background: #fff;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row {
  display: flex;
  flex-wrap: wrap;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item {
  width: 16%;
  position: relative;
  padding: 10px;
  margin: 0;
  display: flex;
  align-items: center;
  justify-content: center;
  min-height: 110px;
  border: 1px solid #e4e4e4;
  border-left: none;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item a {
  flex: 0 0 auto;
  display: inline-block;
  max-width: 100%;
  height: auto;
  font-size: 40px;
  text-decoration: none;
  color: #333333;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item a i {
  display: block;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item span {
  font-size: 16px;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item:first-child {
  border-left: 1px solid #e4e4e4;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item:hover {
  background: rgba(245, 249, 252, 0.25);
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item:hover a {
  color: #3d9de1;
}
.section-block .add-container .content-container .content-files .content-files-list .content-files-row.bt-none .content-files-item {
  border-top: none !important;
}

@media all and (max-width: 1024px) {
  .text-tohide {
    display: none;
  }
  .content-files {
    width: 100%;
  }
  .content-files .content-files-item a {
    font-size: 30px;
  }
  .content-files .content-files-item span {
    display: none;
  }
}
@media all and (max-width: 1300px) and (min-width: 1025px) {
  html:not(.sidebar-left-collapsed) .content-files {
    width: 95% !important;
  }
  html:not(.sidebar-left-collapsed) .content-files .content-files-item a {
    font-size: 30px !important;
  }
  html:not(.sidebar-left-collapsed) .content-files .content-files-item span {
    display: none;
  }
  html.sidebar-left-collapsed .content-files {
    width: 90% !important;
  }
  html.sidebar-left-collapsed .content-files .content-files-item a {
    font-size: 35px !important;
  }
  html.sidebar-left-collapsed .content-files .content-files-item span {
    display: none;
  }
}
.lectures .instructor-resources {
  background-color: #dedede;
  margin-left: -20px !important;
  margin-right: -20px !important;
}

.add-container .section-content,
.section-button .section-content,
.edit-main-section .section-content,
.edit-section .section-content,
.add-downloads .section-content {
  display: block;
  width: 100%;
  text-align: center;
  height: 0;
}
.add-container .section-content .section-new,
.section-button .section-content .section-new,
.edit-main-section .section-content .section-new,
.edit-section .section-content .section-new,
.add-downloads .section-content .section-new {
  display: inline-block;
  background: rgba(245, 249, 252, 0.25);
  overflow: visible;
  visibility: hidden;
  width: 80%;
  height: 0;
  opacity: 0;
  filter: alpha(opacity=0);
  border-radius: 3px;
  transition: all 0.2s ease-in-out;
  box-shadow: 0 0 13px 0 rgba(22, 45, 61, 0.2);
}
.add-container .section-content .section-new .section-border .section-in,
.section-button .section-content .section-new .section-border .section-in,
.edit-main-section .section-content .section-new .section-border .section-in,
.edit-section .section-content .section-new .section-border .section-in,
.add-downloads .section-content .section-new .section-border .section-in {
  display: block;
  width: 100%;
}
.add-container .section-content .section-new .section-border .section-in .section-element,
.section-button .section-content .section-new .section-border .section-in .section-element,
.edit-main-section .section-content .section-new .section-border .section-in .section-element,
.edit-section .section-content .section-new .section-border .section-in .section-element,
.add-downloads .section-content .section-new .section-border .section-in .section-element {
  display: block;
  width: 100%;
  background: #fff;
  text-align: left;
  padding: 15px;
  color: #777;
}
.add-container .add-button-plus,
.section-button .add-button-plus,
.edit-main-section .add-button-plus,
.edit-section .add-button-plus,
.add-downloads .add-button-plus {
  display: block;
  position: relative;
  width: 28px;
  margin: 0 5px;
  cursor: pointer;
  height: 28px;
  background: hsla(0, 0%, 100%, 0.4);
  border: 1px solid rgba(0, 0, 0, 0.4);
  z-index: 100;
  border-radius: 100%;
  float: left;
  transition: background 0.15s ease-in-out, border-color 0.15s ease-in-out;
}
.add-container .add-button-plus:after, .add-container .add-button-plus:before,
.section-button .add-button-plus:after,
.section-button .add-button-plus:before,
.edit-main-section .add-button-plus:after,
.edit-main-section .add-button-plus:before,
.edit-section .add-button-plus:after,
.edit-section .add-button-plus:before,
.add-downloads .add-button-plus:after,
.add-downloads .add-button-plus:before {
  content: "";
  position: absolute;
  top: 8px;
  left: 12px;
  height: 10px;
  width: 2px;
  visibility: visible;
  background: rgba(0, 0, 0, 0.3);
  opacity: 1;
  filter: alpha(opacity=100);
  transition: background 0.15s ease-in-out, opacity 0.15s ease-in-out;
}
.add-container .add-button-plus:after,
.section-button .add-button-plus:after,
.edit-main-section .add-button-plus:after,
.edit-section .add-button-plus:after,
.add-downloads .add-button-plus:after {
  top: 12px;
  left: 8px;
  width: 10px;
  height: 2px;
}
.add-container .add-button-plus.button-content, .add-container .add-button-plus.button-section,
.section-button .add-button-plus.button-content,
.section-button .add-button-plus.button-section,
.edit-main-section .add-button-plus.button-content,
.edit-main-section .add-button-plus.button-section,
.edit-section .add-button-plus.button-content,
.edit-section .add-button-plus.button-section,
.add-downloads .add-button-plus.button-content,
.add-downloads .add-button-plus.button-section {
  width: 90px;
  border-radius: 10px;
  padding: 1px 10px 1px 25px;
  background: #fff;
}

.options-open .border-left,
.options-open .border-rigth,
.section-open .border-left,
.section-open .border-rigth {
  visibility: hidden;
  opacity: 0;
  filter: alpha(opacity=0);
}
.options-open .add-button-plus:before,
.section-open .add-button-plus:before {
  visibility: hidden;
  opacity: 0;
  filter: alpha(opacity=0);
}
.options-open .add-button-plus:after,
.section-open .add-button-plus:after {
  background: #fff;
}
.options-open .add-button-plus.button-content,
.section-open .add-button-plus.button-content {
  background: #101824;
  border-color: hsla(0, 0%, 100%, 0.3);
  margin-left: 60px;
  color: #fff;
}
.options-open .add-button-plus.button-section,
.section-open .add-button-plus.button-section {
  display: none;
}

.options-open .content-container {
  visibility: visible;
  height: 264px !important;
}
.options-open .content-container .content-files {
  visibility: visible !important;
  height: 264px !important;
  opacity: 1 !important;
}

.section-open .section-content {
  min-height: 254px;
  height: auto;
  margin-top: 30px;
}
.section-open .section-content .section-new {
  visibility: visible;
  min-height: 254px;
  opacity: 1;
  height: auto;
}
.section-open .border-left,
.section-open .border-rigth {
  visibility: hidden;
  opacity: 0;
}
.section-open .add-bar-position {
  display: none;
}

/*Run Courses*/
body.course-taking {
  background: #393939;
  margin: 0;
  padding: 0;
  word-wrap: break-word;
  /*Header*/
}
body.course-taking .sidebar-left {
  width: 320px;
}
body.course-taking .main-content-wrapper {
  display: flex;
  min-height: 100vh;
  flex-direction: column;
}
body.course-taking .main-content,
body.course-taking .main-content-wrapper {
  flex: 1 0 auto;
}
body.course-taking .page-header {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
  z-index: 1012;
  top: 0;
  left: 0 !important;
  margin: 0;
  transition: all 0.4s ease;
  background: #393939;
  color: #FFF;
  border-left: 0;
}
body.course-taking .page-header .container-title {
  display: flex;
  flex-direction: row;
}
body.course-taking .page-header .visible-small {
  display: none;
}
body.course-taking .page-header .breadcrumbs {
  display: flex !important;
  line-height: 49px;
  flex-direction: row;
  justify-content: center;
}
body.course-taking .page-header .breadcrumbs li {
  padding: 0 12px;
}
body.course-taking .page-header .breadcrumbs li:not(:first-child) {
  border-left: 1px solid #c3c3c3;
}
body.course-taking .page-header .breadcrumbs .accessibility-menu {
  padding-right: 0px !important;
}
body.course-taking .page-header .toggle-menu-left {
  float: left;
  width: 50px;
  line-height: 50px;
  text-align: center;
  color: #FFF !important;
  font-size: 2rem;
  margin-left: -1px;
  display: none;
  transition: all 0.4s ease;
  cursor: pointer;
}
body.course-taking .page-header .page-header-title {
  font-weight: 600;
  line-height: 1.5;
}
body.course-taking .page-header a .far {
  font-size: 2rem;
}
body.course-taking .page-header a .fas,
body.course-taking .page-header a .text-progress {
  display: block;
  height: 1em;
  margin: 0 auto 5px;
  text-align: center;
}
body.course-taking .page-header a,
body.course-taking .page-header h2,
body.course-taking .page-header span,
body.course-taking .page-header .page-header-title {
  color: #FFF;
}
body.course-taking .page-header a:hover {
  color: #3d9de1 !important;
  text-decoration: none !important;
}
body.course-taking .page-header i:hover {
  color: #3d9de1 !important;
}
body.course-taking .page-header h2 {
  padding: 10px 20px 10px 15px;
}
body.course-taking .page-header a.white-hover:hover {
  color: #fff !important;
}
body.course-taking .page-header i.white-hover:hover {
  color: #fff !important;
}
body.course-taking .sidebar-left {
  top: 0;
  z-index: 1013;
  transition: all 0.4s ease;
}
body.course-taking .sidebar-left .sidebar-header {
  border-bottom: 1px solid #ccc;
}
body.course-taking .sidebar-left .sidebar-header .sidebar-title {
  padding: 8px 49px 10px 5px;
  height: 49px;
}
body.course-taking .sidebar-left .sidebar-header .sidebar-toggle {
  width: 49px;
  border-radius: 0;
  height: 49px !important;
}
body.course-taking .sidebar-left .sidebar-header .sidebar-toggle i {
  color: #FFF !important;
}
body.course-taking .sidebar-left .nano {
  background: #393939 !important;
  box-shadow: -1px 0 0 #202020 inset !important;
}
body.course-taking .sidebar-left ul.nav-main {
  margin: 0 !important;
  margin-right: 5px;
}
body.course-taking .sidebar-left ul.nav-main .section-score {
  font-size: 1.3rem;
}
body.course-taking .sidebar-left ul.nav-main li.nav-active {
  background-color: #393939 !important;
}
body.course-taking .sidebar-left ul.nav-main > li {
  margin-right: 1px;
}
body.course-taking .sidebar-left ul.nav-main > li:first-child > a {
  border-top: none;
}
body.course-taking .sidebar-left ul.nav-main > li > a {
  background: #393939 !important;
  color: #FFF !important;
  font-size: 13px;
  font-weight: 300;
  padding: 14px 15px 14px 10px;
  border-bottom: 1px solid #202020;
}
body.course-taking .sidebar-left ul.nav-main > li > a:after {
  padding: 14px 20px 14px 10px;
}
body.course-taking .sidebar-left ul.nav-main > li > a:hover, body.course-taking .sidebar-left ul.nav-main > li > a:focus {
  background: #535353;
}
body.course-taking .sidebar-left ul.nav-main > li > a cite {
  font-style: normal;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children {
  padding: 0 !important;
  /*background-color: #0C5C82 !important;*/
  background-color: transparent;
  box-shadow: none;
  padding-left: 5px;
  margin-right: 5px;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li {
  background-color: #252525;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a {
  padding: 12px 5px 12px 10px;
  color: #dedede;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:after {
  padding: 14px 15px;
  font-size: 14px;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:hover,
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:focus {
  background-color: #060606;
  color: #fff;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li.nav-expanded.nav-active > a {
  border-bottom: 1px solid #393939;
  margin-right: 5px;
  background-color: #323232;
}
body.course-taking .sidebar-left ul.nav-main > li > ul.nav-children li.nav-active > a {
  color: #3d9de1 !important;
}
body.course-taking .sidebar-left ul.nav-main ul.downloads {
  display: block;
}
body.course-taking .sidebar-left ul.nav-main ul.downloads > li > a {
  padding: 5px 39px 5px 30px !important;
}
body.course-taking .sidebar-left ul.nav-main ul.downloads > lia.tooltip-inner {
  background-color: #73AD21;
  color: #FFFFFF;
  border: 1px solid green;
  padding: 15px;
  font-size: 20px;
}
body.course-taking .content-test {
  margin: 0 auto;
}
body.course-taking .content-test .test-runner-course {
  width: 80%;
  margin: 15px auto 70px auto;
  background: #fff;
  box-shadow: 0 0 20px 0 rgba(0, 0, 0, 0.2), 0 5px 5px 0 rgba(0, 0, 0, 0.24);
  display: flex;
  min-height: 40vh;
}
body.course-taking .content-test .test-runner-course .panel-title p {
  margin-bottom: 0;
}
body.course-taking .content-test span.zoom-text {
  font-size: 12px;
  overflow: auto;
}
body.course-taking .asset-container {
  width: 100%;
  position: relative;
  top: 0;
  left: 0;
  overflow: auto;
}
body.course-taking .asset-container .course-template {
  overflow: auto;
}
body.course-taking .asset-container .course-template .sidebar-right .sidebar-right-wrapper,
body.course-taking .asset-container .course-template .sidebar-right .scrollable {
  height: 100%;
}
body.course-taking .asset-container #frame-content {
  height: 100%;
}
body.course-taking .asset-container .course-html {
  border-radius: 0;
  padding: 20px 50px;
}
body.course-taking .asset-container .course-html.test-start .scrollable-pane {
  z-index: 1011;
}
body.course-taking .asset-container .course-html.test-start .panel-questions .panel-navigation {
  background: transparent;
  border: 0;
  border-bottom: 1px solid #cecece;
  margin-bottom: 0;
  box-shadow: none;
  border-radius: 0;
}
body.course-taking .asset-container .course-html .panel-body.panel-body-starttest {
  background: #fff;
  padding-top: 15vh;
}
body.course-taking .asset-container .course-html .tab-content {
  border-top: 1px solid #EEE;
  overflow-y: auto;
}
body.course-taking .asset-container .course-html .tab-content .panel-body {
  background: #fff;
  box-shadow: none !important;
  border-radius: 0 !important;
}
body.course-taking .asset-container .course-html .tab-content .panel-body.panel-body-starttest {
  height: 75vh;
  padding-top: 15vh;
}
body.course-taking .timeline-item-taking {
  position: fixed;
  top: 50px;
  left: 0;
  height: 100vh;
  z-index: 1011;
  right: 0;
  transition: all 0.4s ease;
}
@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  body.course-taking .timeline-item-taking {
    overflow: visible !important;
  }
}
body.course-taking .player-container {
  background: #393939;
  transition: margin 0.4s ease;
  padding-top: 0px;
  z-index: 1043 !important;
}
body.course-taking .player-container .sidebar-right {
  transition: all 0.4s ease;
}
body.course-taking .player-container .sidebar-right .sidebar-widget.widget-friends ul li {
  padding: 5px 0 5px 0px !important;
}
body.course-taking .player-container .sidebar-right .sidebar-widget.widget-friends ul li .profile-info {
  margin: 0 10px;
  width: 70%;
}
body.course-taking .player-container .sidebar-right .sidebar-widget.widget-friends ul li .profile-info .name {
  text-overflow: ellipsis;
  white-space: nowrap;
  margin: 0;
  font-weight: 500;
}
body.course-taking .fullscreen {
  width: 100%;
  z-index: 1041;
}

/*Fix*/
html.dark-player {
  overflow-y: hidden !important;
}
html.dark-player .sidebar-left .sidebar-header .sidebar-title {
  border-top-left-radius: 0px !important;
  border-top-right-radius: 0px !important;
}
html.dark-player .sidebar-left .sidebar-header .sidebar-title, html.dark-player .sidebar-left .sidebar-header .sidebar-toggle {
  background: #393939 !important;
}

html.sidebar-left-collapsed .course-taking .timeline-item-taking,
html.sidebar-left-collapsed .course-taking .page-header {
  margin-left: 0 !important;
}
html.sidebar-left-collapsed .course-taking .sidebar-left {
  width: 0 !important;
}
html.sidebar-left-collapsed .course-taking .toggle-menu-left {
  display: block;
}

html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .page-header,
html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .timeline-item-taking {
  margin-left: 320px;
}

@media only screen and (max-width: 768px) {
  html .course-taking .page-header {
    flex-wrap: wrap;
    position: fixed;
    right: 0;
    height: 100px;
    padding-right: 0px;
  }
  html .course-taking .page-header .container-title {
    min-width: 767px;
  }
  html .course-taking .page-header .breadcrumbs {
    width: 100%;
    border-top: 1px solid #ccc;
    margin-right: 0px;
  }
  html .course-taking .player-container {
    top: 50px;
  }
  html .course-taking .player-container .asset-container {
    overflow: hidden;
  }
  html .course-taking .player-container .main-preview-player .vjs-video-wrap {
    width: 100%;
    display: flex;
    height: 350px;
  }
  html .course-taking .player-container .main-preview-player .playlist-container {
    display: flex;
    width: 100%;
    position: relative;
    height: calc(100vh - 450px);
    position: fixed;
    top: 450px;
  }
  html .course-taking .player-container .main-preview-player .playlist-container .vjs-playlist-item-list {
    width: 100%;
  }
  html .course-taking .player-container .main-preview-player .playlist-container .vjs-playlist-item-list li.vjs-playlist-item {
    display: flex;
  }
  html .course-taking .player-container .main-preview-player .playlist-container .vjs-playlist-item-list li.vjs-playlist-item p {
    float: left !important;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .sidebar-left {
    left: 0;
    margin-left: 0;
    z-index: 1013 !important;
    padding-top: 0 !important;
    min-width: 50vw !important;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .timeline-item-taking,
  html.sidebar-left-custom:not(.sidebar-right-opened) .page-header {
    margin-left: 0 !important;
  }
  html.sidebar-left-collapsed .sidebar-left {
    left: -100% !important;
  }
}
@media only screen and (min-width: 769px) and (max-width: 1024px) {
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .page-header {
    flex-wrap: wrap;
    height: 100px;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .page-header .container-title {
    width: 657px;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .page-header .breadcrumbs {
    width: 100%;
    border-top: 1px solid #ccc;
    margin-right: 0px;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .player-container {
    top: 50px;
  }
  html.sidebar-left-collapsed .course-taking .page-header {
    flex-wrap: wrap;
  }
  html.sidebar-left-collapsed .course-taking .page-header .container-title {
    width: auto !important;
  }
  html .course-taking .main-preview-player .vjs-video-wrap {
    width: 100%;
    display: flex;
    height: 350px;
  }
  html .course-taking .main-preview-player .playlist-container {
    display: flex;
    width: 100%;
    position: relative;
    height: calc(100vh - 450px);
  }
  html .course-taking .main-preview-player .playlist-container .vjs-playlist-item-list {
    width: 100%;
  }
  html .course-taking .main-preview-player .playlist-container .vjs-playlist-item-list li.vjs-playlist-item {
    display: flex;
  }
  html .course-taking .main-preview-player .playlist-container .vjs-playlist-item-list li.vjs-playlist-item p {
    float: left !important;
  }
}
@media only screen and (min-width: 1025px) and (max-width: 1200px) {
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .main-preview-player .vjs-video-wrap {
    width: 100%;
    display: flex;
    height: 350px;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .main-preview-player .playlist-container {
    display: flex;
    width: 100%;
    position: relative;
  }
  html.sidebar-left-custom:not(.sidebar-right-opened) .course-taking .main-preview-player .playlist-container .vjs-playlist-item-list {
    width: 100%;
  }
  html.sidebar-left-collapsed .course-taking .main-preview-player .vjs-video-wrap {
    width: 80%;
    height: calc(100vh - 50px) !important;
  }
  html.sidebar-left-collapsed .course-taking .main-preview-player .playlist-container {
    width: 20% !important;
    position: absolute !important;
  }
}
html .inner-wrapper.course-run {
  padding-top: 56px;
}

@media only screen and (max-width: 767px) {
  .inner-wrapper.course-run {
    padding-top: 120px !important;
  }
  .course-content {
    padding: 0;
  }
}
@media only screen and (min-width: 768px) {
  .course-content {
    height: calc(100% - 60px);
  }
  html.flexbox .course-content,
  html.flexboxlegacy .course-content {
    box-flex: 2;
    flex: 2;
    min-width: 1px;
  }
  html.fixed .content-body {
    display: block;
  }
}
.course-content {
  padding: 40px;
  position: relative;
  vertical-align: top;
}

.examcertbank .panel-heading {
  padding: 5px 5px 5px 0;
}

.td-ptb-xss > tbody > tr > td {
  padding-top: 3px !important;
  padding-bottom: 3px !important;
}

.course-dashboard .header-course-dashboard {
  color: #FFF;
  background-color: #2e353e;
}
.course-dashboard .header-course-return {
  opacity: 0.5;
  filter: alpha(opacity=50);
  border-radius: 15px 0px 0px 15px;
  z-index: 1;
  position: absolute;
  right: 0;
  height: 50px;
  background-color: #686f7a;
  padding: 0;
  width: 85px;
}
.course-dashboard .header-course-return div {
  width: 100%;
  height: 100%;
}
.course-dashboard .header-course-return a {
  text-decoration: none;
}
.course-dashboard .header-course-return:hover {
  opacity: 1;
  filter: alpha(opacity=100);
  /* For IE8 and earlier */
  background-color: #3d9de1;
}

.header-course-dashboard-content {
  height: 300px;
}

.increase-popover-width {
  max-width: 300px;
  width: 100% !important;
}

@-moz-document url-prefix() {
  .line-clamp.large-title {
    display: -moz-box !important;
    overflow: hidden !important;
    text-overflow: ellipsis;
    white-space: nowrap;
  }
  .full-text.text-justify {
    left: 0px !important;
  }
}
.force-line-clamp {
  text-overflow: ellipsis !important;
  overflow: hidden !important;
  white-space: nowrap !important;
}

.tabs-dashboard-contanier {
  margin-right: auto;
  margin-left: auto;
  width: 98%;
}
@media screen and (max-width: 767px) {
  .tabs-dashboard-contanier {
    padding: 30px 20px;
  }
}

.header-course-dashboard-content,
.elements-course-dashboard-content {
  display: flex;
  justify-content: space-between;
  margin-right: auto;
  margin-left: auto;
  padding-left: 15px;
  padding-right: 15px;
  padding: 30px 0;
  width: 98%;
}
.header-course-dashboard-content:before,
.elements-course-dashboard-content:before {
  content: " ";
  display: table;
}
@media screen and (max-width: 767px) {
  .header-course-dashboard-content,
  .elements-course-dashboard-content {
    padding: 30px 20px;
  }
}
.header-course-dashboard-content .header-course-dashboard-image-container,
.header-course-dashboard-content .elements-course-dashboard-summary-container,
.elements-course-dashboard-content .header-course-dashboard-image-container,
.elements-course-dashboard-content .elements-course-dashboard-summary-container {
  position: relative;
  width: 100%;
  height: 100%;
  display: inline-flex;
  flex-direction: row;
  align-items: center;
  justify-content: center;
  max-width: 425px;
  flex: 0 0 auto;
}
.header-course-dashboard-content .header-course-dashboard-image-container img,
.header-course-dashboard-content .elements-course-dashboard-summary-container img,
.elements-course-dashboard-content .header-course-dashboard-image-container img,
.elements-course-dashboard-content .elements-course-dashboard-summary-container img {
  border-radius: 15px;
}
@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  .header-course-dashboard-content,
  .elements-course-dashboard-content {
    /* IE10+ specific styles go here */
  }
  .header-course-dashboard-content .header-course-dashboard-image-container,
  .header-course-dashboard-content .elements-course-dashboard-summary-container,
  .elements-course-dashboard-content .header-course-dashboard-image-container,
  .elements-course-dashboard-content .elements-course-dashboard-summary-container {
    display: block !important;
  }
  .header-course-dashboard-content .header-course-dashboard-image-container.hidden,
  .header-course-dashboard-content .elements-course-dashboard-summary-container.hidden,
  .elements-course-dashboard-content .header-course-dashboard-image-container.hidden,
  .elements-course-dashboard-content .elements-course-dashboard-summary-container.hidden {
    display: none !important;
  }
}
.header-course-dashboard-content .elements-course-dashboard-summary-container,
.elements-course-dashboard-content .elements-course-dashboard-summary-container {
  justify-content: flex-start;
}
.header-course-dashboard-content .header-course-dashboard-image-container img,
.elements-course-dashboard-content .header-course-dashboard-image-container img {
  transition: opacity 0.25s ease-in-out;
}
@media screen and (max-width: 767px) {
  .header-course-dashboard-content .header-course-dashboard-image-container,
  .elements-course-dashboard-content .header-course-dashboard-image-container {
    display: none;
  }
}
@media screen and (max-width: 991px) {
  .header-course-dashboard-content .header-course-dashboard-image-container,
  .elements-course-dashboard-content .header-course-dashboard-image-container {
    max-width: 350px;
  }
}
@media screen and (max-width: 767px) {
  .header-course-dashboard-content .elements-course-dashboard-summary-container,
  .elements-course-dashboard-content .elements-course-dashboard-summary-container {
    max-width: 100% !important;
    margin-right: 0;
    margin-bottom: 40px;
  }
}
.header-course-dashboard-content .header-course-dashboard-info-container,
.header-course-dashboard-content .elements-course-dashboard-sections-container,
.elements-course-dashboard-content .header-course-dashboard-info-container,
.elements-course-dashboard-content .elements-course-dashboard-sections-container {
  flex: 1;
  min-width: 1px;
  height: 100%;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper {
  display: flex;
  flex-direction: column;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top {
  flex: 1;
  min-width: 1px;
  /*Over text*/
  /*Over text*/
}
@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  .header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top,
  .header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top,
  .elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top,
  .elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top {
    -ms-flex: none !important;
  }
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title {
  color: #fff;
  font-weight: 500;
  font-size: 20px;
  display: block;
  margin-bottom: 20px;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back {
  color: #fff;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back, .header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back:hover,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back:hover,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back:hover,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title .header-course-dashboard-link-back:hover {
  text-decoration: none;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title label,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title label,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title label,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .header-course-dashboard-title label {
  font-size: 12px;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details {
  display: flex;
  align-items: stretch;
  flex-direction: row;
  flex-wrap: wrap;
  justify-content: space-between;
  min-height: 50px;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item {
  flex: 1.5;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item-cero,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item-cero,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item-cero,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details .course-detail-item-cero {
  flex: 0.1;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details h5,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details h5,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details h5,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .hedaer-course-dashboard-details h5 {
  font-weight: bold;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext {
  height: 25px !important;
  position: relative;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext .full-text,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext .full-text,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext .full-text,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext .full-text {
  position: absolute;
  top: 0px;
  left: 0px;
  visibility: hidden;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover {
  height: 27px !important;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .full-text,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .full-text,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .full-text,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .full-text {
  visibility: visible;
  top: 0px;
  left: inherit;
  margin-left: -5px;
  padding-left: 5px;
  padding-right: 5px;
  background-color: #2e353e;
  border: solid 1px #0a0a0a;
  border-radius: 5px;
  box-shadow: 0 4px 8px 0 rgba(0, 0, 0, 0.4), 0 6px 20px 0 rgba(0, 0, 0, 0.39);
  z-index: 100;
  line-height: 35px;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .line-clamp-line-two,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .line-clamp-line-two,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .line-clamp-line-two,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-vertical-flex-wrapper .header-course-info-top .show-fulltext:not(.not-show):hover .line-clamp-line-two {
  position: absolute;
  visibility: hidden;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container {
  display: flex;
  align-items: flex-end;
  width: 100%;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info {
  flex: 1;
  min-width: 1px;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar {
  margin-top: 10px;
  border-radius: 4px;
  overflow: hidden;
  height: 15px;
  width: calc(100% - 5px);
  background-color: #686f7a;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-progress-bar-indicator,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-progress-bar-indicator,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-progress-bar-indicator,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-progress-bar-indicator {
  height: 100%;
  background-color: #fff;
}
.header-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-btn-position,
.header-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-btn-position,
.elements-course-dashboard-content .header-course-dashboard-info-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-btn-position,
.elements-course-dashboard-content .elements-course-dashboard-sections-container .header-course-progress-container .header-course-progress-container-info .header-course-progress-bar .header-course-btn-position {
  margin-right: -90px;
  margin-bottom: -6px;
}

.elements-course-dashboard-content {
  flex-flow: row wrap;
}

.btn-link {
  text-decoration: none;
  color: #3d9de1;
}
.btn-link.active, .btn-link:hover {
  text-decoration: none;
}
.btn-link.active {
  font-weight: 700;
}
.btn-link:hover {
  color: #1f84cc;
}

.glossary-result-notfound {
  display: flex;
  flex-direction: column;
}
.glossary-result-notfound i {
  font-size: 60px;
}
.glossary-result-notfound span {
  padding-top: 10px;
  font-size: 20px;
}

.course-content-dashboard .course-content-dahsboard-menu {
  display: flex;
  flex-wrap: wrap;
  flex-shrink: 0;
}
@media (min-width: 768px) {
  .course-content-dashboard .course-content-dahsboard-menu {
    display: flex;
    flex-direction: row;
    align-items: center;
    justify-content: center;
  }
}
.course-content-dashboard .course-content-dahsboard-menu .in-course-search {
  flex: 1;
  margin: 5px 0;
  width: 100%;
}
.course-content-dashboard .course-content-dahsboard-menu .course-content-filters {
  display: flex;
  flex: 2;
  justify-content: flex-end;
}
.course-content-dashboard .course-content-sections {
  overflow-y: auto;
  padding: 10px;
  margin: -10px;
}
.course-content-dashboard .course-content-sections .active-letter {
  border-color: #CCC;
  padding: 3px 6px;
  text-decoration: none !important;
}
.course-content-dashboard .course-content-sections .active-letter:visited {
  text-decoration: none !important;
}
.course-content-dashboard .course-content-sections .course-sections-result-notfound {
  display: flex;
  align-items: center;
  justify-content: center;
  flex-direction: column;
  padding-top: 40px;
}
.course-content-dashboard .course-content-sections .course-sections-result-notfound > div {
  text-align: center;
  display: flex;
  flex-flow: inherit;
}
.course-content-dashboard .course-content-sections .course-sections-result-notfound i {
  font-size: 60px;
}
.course-content-dashboard .course-content-sections .course-sections-result-notfound span {
  padding-top: 10px;
  font-size: 20px;
}
.course-content-dashboard .course-content-sections .course-content-lesson.panel {
  color: #4a4a4a;
  border-color: #b5b5b5;
}
.course-content-dashboard .course-content-sections .course-content-lesson .panel-collapse.collapse.in ul:first-child {
  border-top: 1px solid #b5b5b5;
}
.course-content-dashboard .course-content-sections .course-content-lesson .panel-body {
  background-color: #cecece;
  padding: 0;
  border-radius: 0;
}
.course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading {
  display: flex;
  justify-content: space-between;
  flex-wrap: nowrap;
  padding: 10px 25px 0 10px;
  position: relative;
}
.course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading h5 {
  font-weight: 700;
  margin-top: 5px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading:hover {
  cursor: pointer;
}
.course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading a {
  text-decoration: none;
}
@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  .course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading {
    display: -ms-flexbox !important;
  }
  .course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading h5 {
    display: -ms-flexbox !important;
    -ms-flex: 1;
  }
}
.course-content-dashboard .course-content-sections .course-content-lesson .has-items {
  padding-right: 25px !important;
}
.course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading:after,
.course-content-dashboard .course-content-sections .course-content-lesson .has-items:after {
  font-family: "Font Awesome 5 Pro";
  content: "\f107";
  font-size: 1.6rem;
  color: #4a4a4a;
  position: absolute;
  right: 0;
  top: 0;
  padding: 10px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .lesson-heading.expanded:after,
.course-content-dashboard .course-content-sections .course-content-lesson .has-items.expanded:after {
  content: "\f106";
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items {
  margin-bottom: 0;
  border: none;
  box-shadow: none;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items:before {
  content: "";
  position: absolute;
  left: 0;
  top: 0;
  width: 100%;
  height: 100%;
  transition: 0.2s ease;
  pointer-events: none;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body {
  background-color: white;
  border-radius: 0 0 4px 4px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul {
  list-style: none;
  margin: 0;
  padding: 0;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul.ulgray {
  padding-top: 5px !important;
  padding-bottom: 5px !important;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul.ul-collapse {
  border-top: 1px solid #dbdbdb;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item {
  position: relative;
  border-top: 1px solid #dbdbdb;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item:first-child {
  border-top: none;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item.sub-item {
  padding-left: 30px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item.sub-item .resources-list {
  padding-left: 45px !important;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .resources-list {
  padding: 0px;
  margin: 0 0 10px 0;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .resources-list.sub-content {
  padding-left: 30px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .resources-list i {
  font-size: 16px;
  margin-right: 10px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link {
  display: flex;
  justify-content: space-between;
  color: #686f7a;
  padding: 10px;
  text-decoration: none;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link:hover {
  background: #e8e8e8;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-type {
  height: 24px;
  width: 24px;
  font-size: 16px;
  border-radius: 50%;
  text-align: center;
  padding: 1px 0 0 1px;
  order: 1;
  margin-right: 10px;
  color: #000;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-type.item-section {
  width: 0 !important;
  margin-right: 0 !important;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-bookmark {
  height: 24px;
  width: 24px;
  font-size: 16px;
  text-align: center;
  padding: 1px 0 0 1px;
  order: 2;
  margin-right: 10px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-title {
  flex: 1;
  min-width: 1px;
  order: 3;
  margin-right: 5px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-details {
  order: 4;
  opacity: 0.7;
  margin-right: 30px;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-status {
  height: 20px;
  width: 20px;
  font-size: 16px;
  border-radius: 50%;
  text-align: center;
  padding: 0;
  order: 6;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-totals {
  text-align: center;
  padding: 0;
  order: 5;
}
.course-content-dashboard .course-content-sections .course-content-lesson .course-content-lesson-items .panel-body ul li.curriculum-item .curriculum-item-link .curriculum-item-score {
  text-align: center;
  padding: 0;
  order: 4;
}
.course-content-dashboard .modal-finish-lessons {
  height: 300px !important;
  overflow-y: scroll;
}

.number-label {
  opacity: 1;
}

.btn-action {
  opacity: 0;
  position: absolute;
  margin-top: -17px;
}

.btn-margin-auto {
  margin: auto !important;
  margin-left: -10px !important;
}

tr.hover-delete:hover .number-label {
  opacity: 0 !important;
}

tr.hover-delete:hover .btn-action {
  opacity: 1 !important;
}

.course-vp {
  width: 100% !important;
  max-height: 200px !important;
  min-height: 200px !important;
}

.usedtooltip tooltip {
  position: absolute;
}
.usedtooltip tooltip tip {
  padding: 2px 5px 5px 5px !important;
  /*min-width: unset;*/
  left: 60%;
  top: -15px;
  width: max-content;
}
.usedtooltip .separelelemte tooltip:first-child tip-cont {
  margin-left: 25px !important;
}
.usedtooltip .tooltip-padding-100-p tooltip tip tip-tip {
  padding-left: 15px !important;
}

.post-image {
  min-height: unset !important;
}

.icon-show {
  transition: 0.5s ease;
  opacity: 0;
  position: absolute;
  top: 50%;
  left: 50%;
  transform: translate(-50%, -50%);
  -ms-transform: translate(-50%, -50%);
  text-align: center;
  font-size: 5rem;
}

.hover-show {
  position: relative;
}

.hover-show:hover .course-vp,
.hover-show:hover .img-responsive {
  opacity: 0.3;
  background-color: rgba(0, 0, 0, 0.28);
}

.hover-show:hover .icon-show {
  opacity: 1;
}

.no-vp {
  border-style: dashed;
  border-width: 1px;
  font-family: verdana, arial;
  font-size: 10pt;
  text-align: center;
}

.default-vp {
  position: absolute;
  top: 50%;
  left: 50%;
  transform: translate(-50%, -50%);
  -ms-transform: translate(-50%, -50%);
  text-align: center;
  font-size: 10rem;
  height: 75%;
}
.default-vp i {
  color: #ddd;
}

.customtime {
  width: calc(33% - 5px) !important;
  margin-right: 5px;
}

.refres-input-time .alert-link {
  color: #555 !important;
}
.refres-input-time .alert-link:hover {
  color: #337ab7 !important;
}

.overlay-button {
  display: flex;
  justify-content: center;
  align-items: center;
  position: absolute;
  z-index: 2;
  background: rgba(39, 42, 43, 0.6);
  transition: opacity 200ms ease-in-out;
  border-radius: 4px;
  opacity: 1;
  bottom: 10px;
}

@media screen and (-ms-high-contrast: active), screen and (-ms-high-contrast: none) {
  .overlay-button {
    display: block !important;
    right: 30%;
    bottom: 15px !important;
  }
}
.modal-content-630 {
  max-height: 630px !important;
  min-height: 500px !important;
}

.table-scroll-vertical {
  min-height: 40px !important;
  max-height: 450px !important;
  overflow-y: auto;
  overflow-x: hidden;
  padding-right: 10px !important;
}

.table-glossary .options-save {
  position: relative;
}
.table-glossary .options-save .option {
  margin: 0;
  position: absolute;
  top: 50%;
  transform: translateY(-50%);
  right: 0;
}
.table-glossary tr td:nth-child(1),
.table-glossary th td:nth-child(1) {
  width: 20px !important;
}
.table-glossary tr td:nth-child(2),
.table-glossary th td:nth-child(2) {
  width: 20% !important;
}
.table-glossary tr td:nth-child(3),
.table-glossary th td:nth-child(3) {
  width: calc(80% - 100px) !important;
}
.table-glossary tr td:nth-child(4),
.table-glossary th td:nth-child(4) {
  width: 80px !important;
}

.glosary-ok {
  max-height: 300px !important;
}

.glosary-error {
  max-height: 200px !important;
}

.table-glossary-preview tr td:nth-child(1),
.table-glossary-preview th td:nth-child(1) {
  width: 20px !important;
}
.table-glossary-preview tr td:nth-child(2),
.table-glossary-preview th td:nth-child(2) {
  width: 20% !important;
}
.table-glossary-preview tr td:nth-child(3),
.table-glossary-preview th td:nth-child(3) {
  width: calc(80% - 20px) !important;
}

.table-glossary-preview tr td:nth-child(1),
.table-glossary-preview th td:nth-child(1) {
  width: 20px !important;
}
.table-glossary-preview tr td:nth-child(2),
.table-glossary-preview th td:nth-child(2) {
  width: 20% !important;
}
.table-glossary-preview tr td:nth-child(3),
.table-glossary-preview th td:nth-child(3) {
  width: calc(80% - 20px) !important;
}

.my-pens {
  animation: appear 10s 1;
  animation-delay: 5s;
  animation-fill-mode: forwards;
  opacity: 10;
  position: fixed;
  right: 0rem;
  top: inherit;
  z-index: 1000;
}

.my-pens .author {
  cursor: pointer;
  position: relative;
  background-color: #686f7a;
  width: 90px;
  height: 70px;
  border-radius: 25px 0px 0px 25px;
  display: inline-block;
  text-align: center;
  line-height: 0px;
}
.my-pens .author span.return {
  text-align: center;
  display: block;
  padding-top: 13px;
  text-decoration: none;
}

#backHome:hover {
  background: #3d9de1;
}

.my-pens .author img {
  animation: notice-me 8s infinite;
  animation-delay: 2s;
  animation-fill-mode: forwards;
  position: relative;
  z-index: 30;
  width: 4.375em;
  height: 4.375em;
  border-radius: 50%;
  border: 1px solid #000;
  transition: all 0.3s;
}

.input-rounded {
  border-top-left-radius: 4px !important;
  border-bottom-left-radius: 4px !important;
}

.align-hover .overlay {
  border-radius: 0 !important;
  top: 0;
  left: 0;
}

.pn-ProductNav_Contents a {
  text-decoration: none;
}

.overlay {
  display: flex;
  justify-content: center;
  align-items: center;
  position: absolute;
  z-index: 2;
  opacity: 0;
  background: rgba(39, 42, 43, 0.6);
  transition: opacity 200ms ease-in-out;
  border-radius: 4px;
  width: 100% !important;
  height: 100% !important;
}
.overlay.overlay-awards {
  width: calc(100% - 30px) !important;
}

.overlay:hover {
  opacity: 1;
}

.overlay .label {
  font-size: 3rem;
  font-weight: normal;
  border-radius: 20px;
}

.overlay i {
  font-size: 45px;
  color: #fff;
}

.panel-contacts-course {
  border: 0 none !important;
}
.panel-contacts-course .panel-heading {
  padding-left: 0 !important;
  padding-top: 0 !important;
  padding-bottom: 3px !important;
}
.panel-contacts-course .panel-heading h5 {
  padding-bottom: 3px;
}
.panel-contacts-course .panel-heading .panel-actions {
  right: 15px;
  position: absolute;
  top: -10px;
}
.panel-contacts-course .panel-body {
  padding: 0 0 0 0 !important;
}
.panel-contacts-course .panel-body .pos-fl {
  float: left;
  padding-right: 13px;
  padding-top: 5px;
}
.panel-contacts-course .panel-body .info-contact {
  padding-top: 3px;
  font-size: 13px;
  margin-left: 23px;
}

.text-help {
  min-height: 20px;
  margin-bottom: 5px;
}

.container-contact {
  position: absolute;
  height: inherit;
}
.container-contact .bottom-rigth-option {
  position: relative;
  top: 75%;
  left: 87%;
  font-size: 25px;
}
.container-contact .bottom-rigth-option:hover {
  color: skyblue;
}

.multiselect-container.dropdown-menu li.disabled label {
  color: white !important;
}

.height-contacts {
  max-height: 250px !important;
  overflow-y: auto !important;
}

#question-content .call-to-action.call-to-action-top {
  margin: 0px !important;
  border-radius: 0;
  padding: 40px 25px;
}
#question-content blockquote {
  text-align: center !important;
  border-left: none !important;
}
#question-content blockquote p {
  font-size: 18px !important;
}
#question-content blockquote small {
  font-size: 15px !important;
}
#question-content div.container-content-test div {
  margin-left: 35px !important;
  margin-right: 35px !important;
  margin-top: 10px !important;
}
#question-content div.container-content-test h5 {
  margin-left: 35px !important;
  margin-top: 15px !important;
}
#question-content div.container-content-test i {
  margin-left: 35px !important;
  margin-right: 35px !important;
  margin-top: 10px !important;
}
#question-content div.container-content-test-empty {
  height: 100px !important;
  margin: 100px !important;
}
#question-content .top-banner-green-test {
  background-color: #A3D3A3 !important;
}
#question-content .btn-success-test {
  background-color: #6FA746 !important;
  border-color: #fff !important;
  border: none;
  padding: 6px 12px !important;
  border-radius: 10px;
  box-shadow: 0px 8px 15px rgba(0, 0, 0, 0.1);
  transition: all 0.3s ease 0s;
  cursor: pointer;
  outline: none;
}
#question-content .btn-success-test:hover {
  background-color: #fff;
  box-shadow: 0px 15px 20px rgba(0, 0, 0, 0.4);
  color: #fff;
  transform: translateY(-7px);
}
#question-content .top-banner-danger-test {
  background-color: #ff5c33 !important;
}
#question-content .btn-danger-test {
  background-color: #ff3300 !important;
  border-color: #fff !important;
  border: none;
  padding: 6px 12px !important;
  border-radius: 10px;
  box-shadow: 0px 8px 15px rgba(0, 0, 0, 0.1);
  transition: all 0.3s ease 0s;
  cursor: pointer;
  outline: none;
}
#question-content .btn-danger-test:hover {
  background-color: #fff;
  box-shadow: 0px 15px 20px rgba(0, 0, 0, 0.4);
  color: #fff;
  transform: translateY(-7px);
}
#question-content .btn-primary-test {
  background-color: #47a447 !important;
  border-color: #47a447 !important;
  border: none;
  padding: 6px 12px !important;
  border-radius: 10px;
  box-shadow: 0px 8px 15px rgba(0, 0, 0, 0.1);
  transition: all 0.3s ease 0s;
  cursor: pointer;
  outline: none;
}
#question-content .btn-primary-test:hover {
  background-color: #fff;
  box-shadow: 0px 15px 20px rgba(0, 0, 0, 0.4);
  color: #fff;
  transform: translateY(-7px);
}
#question-content .loading {
  position: absolute;
  margin: 30px 11px 12px 60px;
  width: 112px;
  height: 70px;
  *zoom: 1;
}
#question-content .loading:before {
  display: table;
  content: "";
}
#question-content .loading:after {
  display: table;
  content: "";
  clear: both;
}
#question-content .loading .finger {
  float: left;
  margin: 0 2px 0 0;
  width: 20px;
  height: 100%;
}
#question-content .loading .finger-1 {
  animation: finger-1-animation 2s infinite ease-out;
}
#question-content .loading .finger-1 span {
  animation: finger-1-animation-span 2s infinite ease-out;
}
#question-content .loading .finger-1 i {
  animation: finger-1-animation-i 2s infinite ease-out;
}
#question-content .loading .finger-2 {
  animation: finger-2-animation 2s infinite ease-out;
}
#question-content .loading .finger-2 span {
  animation: finger-2-animation-span 2s infinite ease-out;
}
#question-content .loading .finger-2 i {
  animation: finger-2-animation-i 2s infinite ease-out;
}
#question-content .loading .finger-3 {
  animation: finger-3-animation 2s infinite ease-out;
}
#question-content .loading .finger-3 span {
  animation: finger-3-animation-span 2s infinite ease-out;
}
#question-content .loading .finger-3 i {
  animation: finger-3-animation-i 2s infinite ease-out;
}
#question-content .loading .finger-4 {
  animation: finger-4-animation 2s infinite ease-out;
}
#question-content .loading .finger-4 span {
  animation: finger-4-animation-span 2s infinite ease-out;
}
#question-content .loading .finger-4 i {
  animation: finger-4-animation-i 2s infinite ease-out;
}
#question-content .loading .finger-item {
  position: relative;
  width: 100%;
  height: 100%;
  -webkit-border-radius: 6px 6px 8px 8px;
  -webkit-background-clip: padding-box;
  -moz-border-radius: 6px 6px 8px 8px;
  -moz-background-clip: padding;
  border-radius: 6px 6px 8px 8px;
  background-clip: padding-box;
  background: #fff;
}
#question-content .loading .finger-item span {
  position: absolute;
  left: 0;
  top: 0;
  width: 100%;
  height: auto;
  padding: 5px 5px 0 5px;
}
#question-content .loading .finger-item span:before, #question-content .loading .finger-item span:after {
  content: "";
  position: relative;
  display: block;
  margin: 0 0 2px 0;
  width: 100%;
  height: 2px;
  background: #4492f4;
}
#question-content .loading .finger-item i {
  position: absolute;
  left: 3px;
  bottom: 3px;
  width: 14px;
  height: 14px;
  -webkit-border-radius: 10px 10px 7px 7px;
  -webkit-background-clip: padding-box;
  -moz-border-radius: 10px 10px 7px 7px;
  -moz-background-clip: padding;
  border-radius: 10px 10px 7px 7px;
  background-clip: padding-box;
  background: #4492f4;
}
#question-content .loading .last-finger {
  position: relative;
  float: left;
  width: 24px;
  height: 100%;
  overflow: hidden;
}
#question-content .loading .last-finger-item {
  position: absolute;
  right: 0;
  top: 32px;
  width: 110%;
  height: 20px;
  -webkit-border-radius: 0 5px 14px 0;
  -webkit-background-clip: padding-box;
  -moz-border-radius: 0 5px 14px 0;
  -moz-background-clip: padding;
  border-radius: 0 5px 14px 0;
  background-clip: padding-box;
  background: #fff;
  animation: finger-5-animation 2s infinite linear;
}
#question-content .loading .last-finger-item i {
  position: absolute;
  left: 0;
  top: -8px;
  width: 22px;
  height: 8px;
  background: #fff;
  overflow: hidden;
}
#question-content .loading .last-finger-item i:after {
  content: "";
  position: absolute;
  left: 0;
  bottom: 0;
  width: 34px;
  height: 20px;
  -webkit-border-radius: 0 0 15px 15px;
  -webkit-background-clip: padding-box;
  -moz-border-radius: 0 0 15px 15px;
  -moz-background-clip: padding;
  border-radius: 0 0 15px 15px;
  background-clip: padding-box;
  background: #4492f4;
}
@keyframes finger-1-animation {
  0% {
    padding: 12px 0 5px 0;
  }
  20% {
    padding: 12px 0 5px 0;
  }
  29% {
    padding: 4px 0 24px 0;
  }
  35% {
    padding: 4px 0 24px 0;
  }
  41% {
    padding: 12px 0 5px 0;
  }
  100% {
    padding: 12px 0 5px 0;
  }
}
@keyframes finger-1-animation-span {
  0% {
    top: 0;
  }
  20% {
    top: 0;
  }
  29% {
    top: -7px;
  }
  35% {
    top: -7px;
  }
  41% {
    top: 0;
  }
  100% {
    top: 0;
  }
}
@keyframes finger-1-animation-i {
  0% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  20% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  29% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  35% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  41% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  100% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
}
@keyframes finger-2-animation {
  0% {
    padding: 6px 0 2px 0;
  }
  24% {
    padding: 6px 0 2px 0;
  }
  33% {
    padding: 2px 0 16px 0;
  }
  39% {
    padding: 2px 0 16px 0;
  }
  45% {
    padding: 6px 0 2px 0;
  }
  100% {
    padding: 6px 0 2px 0;
  }
}
@keyframes finger-2-animation-span {
  0% {
    top: 0;
  }
  24% {
    top: 0;
  }
  33% {
    top: -7px;
  }
  39% {
    top: -7px;
  }
  45% {
    top: 0;
  }
  100% {
    top: 0;
  }
}
@keyframes finger-2-animation-i {
  0% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  24% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  33% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  39% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  45% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  100% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
}
@keyframes finger-3-animation {
  0% {
    padding: 0 0 0 0;
  }
  28% {
    padding: 0 0 0 0;
  }
  37% {
    padding: 0 0 12px 0;
  }
  43% {
    padding: 0 0 12px 0;
  }
  49% {
    padding: 0 0 0 0;
  }
  100% {
    padding: 0 0 0 0;
  }
}
@keyframes finger-3-animation-span {
  0% {
    top: 0;
  }
  28% {
    top: 0;
  }
  37% {
    top: -7px;
  }
  43% {
    top: -7px;
  }
  49% {
    top: 0;
  }
  100% {
    top: 0;
  }
}
@keyframes finger-3-animation-i {
  0% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  28% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  37% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  43% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  49% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  100% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
}
@keyframes finger-4-animation {
  0% {
    padding: 8px 0 3px 0;
  }
  32% {
    padding: 8px 0 3px 0;
  }
  41% {
    padding: 4px 0 20px 0;
  }
  47% {
    padding: 4px 0 20px 0;
  }
  53% {
    padding: 8px 0 3px 0;
  }
  100% {
    padding: 8px 0 3px 0;
  }
}
@keyframes finger-4-animation-span {
  0% {
    top: 0;
  }
  32% {
    top: 0;
  }
  41% {
    top: -7px;
  }
  47% {
    top: -7px;
  }
  53% {
    top: 0;
  }
  100% {
    top: 0;
  }
}
@keyframes finger-4-animation-i {
  0% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  32% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  41% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  47% {
    bottom: 8px;
    height: 12px;
    -webkit-border-radius: 7px 7px 4px 4px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 7px 7px 4px 4px;
    -moz-background-clip: padding;
    border-radius: 7px 7px 4px 4px;
    background-clip: padding-box;
  }
  53% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
  100% {
    bottom: 3px;
    height: 14px;
    -webkit-border-radius: 10px 10px 7px 7px;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 10px 10px 7px 7px;
    -moz-background-clip: padding;
    border-radius: 10px 10px 7px 7px;
    background-clip: padding-box;
  }
}
@keyframes finger-5-animation {
  0% {
    top: 32px;
    right: 0;
    -webkit-border-radius: 0 5px 14px 0;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 0 5px 14px 0;
    -moz-background-clip: padding;
    border-radius: 0 5px 14px 0;
    background-clip: padding-box;
    transform: rotate(0deg);
  }
  34% {
    top: 32px;
    right: 0;
    -webkit-border-radius: 0 5px 14px 0;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 0 5px 14px 0;
    -moz-background-clip: padding;
    border-radius: 0 5px 14px 0;
    background-clip: padding-box;
    transform: rotate(0deg);
  }
  43% {
    top: 20px;
    right: 2px;
    -webkit-border-radius: 0 8px 20px 0;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 0 8px 20px 0;
    -moz-background-clip: padding;
    border-radius: 0 8px 20px 0;
    background-clip: padding-box;
    transform: rotate(-12deg);
  }
  50% {
    top: 20px;
    right: 2px;
    -webkit-border-radius: 0 8px 20px 0;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 0 8px 20px 0;
    -moz-background-clip: padding;
    border-radius: 0 8px 20px 0;
    background-clip: padding-box;
    transform: rotate(-12deg);
  }
  60% {
    top: 32px;
    right: 0;
    -webkit-border-radius: 0 5px 14px 0;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 0 5px 14px 0;
    -moz-background-clip: padding;
    border-radius: 0 5px 14px 0;
    background-clip: padding-box;
    transform: rotate(0deg);
  }
  100% {
    top: 32px;
    right: 0;
    -webkit-border-radius: 0 5px 14px 0;
    -webkit-background-clip: padding-box;
    -moz-border-radius: 0 5px 14px 0;
    -moz-background-clip: padding;
    border-radius: 0 5px 14px 0;
    background-clip: padding-box;
    transform: rotate(0deg);
  }
}
#question-content * {
  -khtml-box-sizing: border-box;
  -ms-box-sizing: border-box;
  box-sizing: border-box;
}
#question-content body {
  font-family: "Open Sans", sans-serif;
  background: #4492f4;
}

.retake-principal-container {
  min-height: 100px !important;
}
.retake-principal-container .circular-bar label {
  display: block;
  font-weight: 100;
  font-size: 17px !important;
  line-height: 20px;
  position: absolute;
  top: 42%;
  width: 80%;
  left: 10%;
  text-align: center;
}

.container-retakes {
  vertical-align: text-top;
  display: table-cell;
  margin-top: 15px;
  padding-right: 15px;
}

.btn-primary-disabled {
  background-color: #337ab7 !important;
  border-color: #2e6da4 !important;
  color: white;
}
.btn-primary-disabled.hover {
  color: white;
}

.show-answers-summary {
  margin: 10px;
  padding-left: 15px;
}
.show-answers-summary h2 {
  font-size: 15px !important;
}

.finish-status-list .circular-bar strong {
  font-size: 12px !important;
}
.finish-status-list .show-info {
  margin: 40px auto 0;
}
.finish-status-list svg {
  width: 30px;
  height: 30px;
  display: block;
  margin: 60px auto 0;
}
.finish-status-list .path {
  stroke-dasharray: 1000;
  stroke-dashoffset: 0 !important;
}
.finish-status-list .path.circle {
  animation: dash 0.9s ease-in-out;
}
.finish-status-list .path.line {
  stroke-dashoffset: 1000;
  animation: dash 0.9s 0.35s ease-in-out forwards;
}
.finish-status-list .path.check {
  stroke-dashoffset: -100;
  animation: dash-check 0.9s 0.35s ease-in-out forwards;
}
.finish-status-list h5 {
  text-align: left;
  font-size: 18px;
}
.finish-status-list h5.success {
  color: #73AF55 !important;
}
.finish-status-list h5.fail {
  color: #D06079 !important;
}
@keyframes dash {
  0% {
    stroke-dashoffset: 1000;
  }
  100% {
    stroke-dashoffset: 0;
  }
}
@keyframes dash-check {
  0% {
    stroke-dashoffset: -100;
  }
  100% {
    stroke-dashoffset: 900;
  }
}

input.flag-chk[type=checkbox] {
  display: none;
}
input.flag-chk[type=checkbox] + label {
  font-size: 15px;
  /* defines the size of the check box */
  cursor: pointer;
}
input.flag-chk[type=checkbox] + label i {
  color: gray;
}
input.flag-chk[type=checkbox]:checked + label i {
  color: orange;
}

.row-summary-container {
  display: flex;
  flex-direction: row;
  flex-wrap: wrap;
  width: 100%;
  margin-top: 40px;
}
.row-summary-container .item {
  display: flex;
  flex-direction: column;
  flex-basis: 100%;
  flex: 1;
  flex-direction: row;
  margin: 0 5px;
}

.bar-summary .bar-icon {
  font-size: 26px;
}

.finish-status-list h5 {
  font-size: 26px;
}
.finish-status-list h6 {
  font-size: 18px;
}

@media (max-width: 1600px) {
  .bar-summary .bar-icon {
    font-size: 32px;
  }
  .finish-status-list h5 {
    font-size: 24px;
  }
  .finish-status-list h6 {
    font-size: 16px;
  }
  html:not(.sidebar-left-collapsed) .bar-summary .bar-icon {
    font-size: 24px;
  }
  html:not(.sidebar-left-collapsed) .finish-status-list h5 {
    font-size: 18px;
  }
  html:not(.sidebar-left-collapsed) .finish-status-list h6 {
    font-size: 10px;
  }
  html:not(.sidebar-left-collapsed) .circular-bar label {
    font-size: 10px;
  }
  html:not(.sidebar-left-collapsed) .circular-bar strong {
    font-size: 8px !important;
  }
  html:not(.sidebar-left-collapsed) .circular-bar canvas {
    width: 100px;
  }
}
@media (max-width: 1024px) {
  .bar-summary .bar-icon {
    font-size: 28px;
  }
  .finish-status-list h5 {
    font-size: 20px;
  }
  .finish-status-list h6 {
    font-size: 10px;
  }
  html:not(.sidebar-left-collapsed) .bar-summary .bar-icon {
    font-size: 22px;
  }
  html:not(.sidebar-left-collapsed) .finish-status-list h5 {
    font-size: 16px;
  }
  html:not(.sidebar-left-collapsed) .finish-status-list h6 {
    font-size: 8px;
  }
}
@media (max-width: 767px) {
  .bar-summary .bar-icon {
    font-size: 20px;
  }
  .finish-status-list h5 {
    font-size: 18px;
  }
  .finish-status-list h6 {
    font-size: 10px;
  }
}
/*Diseño para probar el scroll de los tabs al tomar un test dentro de un curso, Miguel*/
.pn-ProductNav_Wrapper {
  background: #fff;
  position: relative;
  padding: 0 11px;
  box-sizing: border-box;
}

.pn-ProductNav {
  /* Make this scrollable when needed */
  overflow-x: hidden;
  /* We don't want vertical scrolling */
  overflow-y: hidden;
  /* For WebKit implementations, provide inertia scrolling */
  -webkit-overflow-scrolling: touch;
  /* We don't want internal inline elements to wrap */
  white-space: nowrap;
  /* If JS present, let's hide the default scrollbar */
  /* positioning context for advancers */
  position: relative;
  font-size: 0;
}

.js .pn-ProductNav {
  /* Make an auto-hiding scroller for the 3 people using a IE */
  -ms-overflow-style: -ms-autohiding-scrollbar;
  /* Remove the default scrollbar for WebKit implementations */
}
.js .pn-ProductNav::-webkit-scrollbar {
  display: none;
}

.pn-ProductNav_Contents {
  float: left;
  transition: transform 0.2s ease-in-out;
  position: relative;
}

.pn-ProductNav_Contents-no-transition {
  transition: none;
}

.pn-ProductNav_Link {
  text-decoration: none;
  color: #A2AAB0;
  font-size: 1.2rem;
  font-family: -apple-system, sans-serif;
  display: inline-flex;
  align-items: center;
  min-height: 44px;
  padding: 0 11px;
}
.pn-ProductNav_Link:hover, .pn-ProductNav_Link:focus {
  color: #A2AAB0;
}
.pn-ProductNav_Link + .pn-ProductNav_Link {
  border-left-color: #ccc;
}
.pn-ProductNav_Link[aria-selected=true] {
  color: #000;
}
.pn-ProductNav_Link.active {
  border-bottom: 3px solid #000;
  border-right: 0px;
  border-left: 0px;
}

.pn-Advancer {
  /* Reset the button */
  appearance: none;
  background: transparent;
  padding: 0;
  border: 0;
  /* Now style it as needed */
  position: absolute;
  top: 0;
  bottom: 0;
  /* Set the buttons invisible by default */
  opacity: 0;
  transition: opacity 0.3s;
}
.pn-Advancer:focus {
  outline: 0;
}
.pn-Advancer:hover {
  cursor: pointer;
}

.pn-Advancer_Left {
  left: 0;
}

[data-overflowing=both] ~ .pn-Advancer_Left,
[data-overflowing=left] ~ .pn-Advancer_Left {
  opacity: 1;
}

.pn-Advancer_Right {
  right: 0;
}

[data-overflowing=both] ~ .pn-Advancer_Right,
[data-overflowing=right] ~ .pn-Advancer_Right {
  opacity: 1;
}

.pn-Advancer_Icon {
  width: 20px;
  height: 44px;
  fill: #bbb;
}

.pn-ProductNav_Indicator {
  position: absolute;
  bottom: 0;
  left: 0;
  height: 4px;
  width: 100px;
  background-color: #000 !important;
  transform-origin: 0 0;
  transition: transform 0.2s ease-in-out, background-color 0.2s ease-in-out;
}

aside.sidebar-right ul.navigation a {
  cursor: context-menu !important;
}
aside.sidebar-right ul.navigation span.answered {
  color: #A1CD18 !important;
  border-radius: 15px;
}
aside.sidebar-right .status-div {
  position: absolute;
  left: 0;
  width: 100%;
  bottom: 0;
  margin: 15px;
  min-height: 150px;
}
aside.sidebar-right a {
  text-decoration: none !important;
}
aside.sidebar-right .navigation-block {
  width: 25px !important;
  height: 25px !important;
  line-height: 25px !important;
  font-size: 10px !important;
  text-align: center;
  display: inline-block;
  background-color: #bdbdbd;
  border-radius: 15px;
}
aside.sidebar-right #navigation {
  -ms-overflow-style: auto;
  height: calc(100% - 150px);
}

.status-list-notations p {
  display: inline-block;
  vertical-align: middle;
  margin-left: 10px;
}
.status-list-notations table a.navigation-block {
  text-decoration: none !important;
  cursor: context-menu !important;
  pointer-events: none;
}
.status-list-notations table td a {
  text-decoration: none !important;
  cursor: pointer;
}

.navigation-block.notanswered {
  background-color: #D3D3D3 !important;
  color: #7A7979 !important;
}

.navigation .incorrectanswered {
  color: #FE9031 !important;
}

.navigation-block.incorrectanswered {
  background-color: #FE9031 !important;
  color: #7A7979;
}
.navigation-block.answered {
  background-color: #A1CD18 !important;
  color: #fff0f5;
}
.navigation-block.marktoreturn {
  background-color: #42ABE4 !important;
  color: #fff0f5;
}
.navigation-block.current {
  background-color: #FE9031 !important;
  color: #fff0f5;
  font-weight: bold;
}

.category-group-courses courses-container spinnerui {
  min-height: 60vh;
}
.category-group-courses .title h1 {
  font-size: 1.6rem;
  font-weight: bold;
}
.category-group-courses .search-category {
  display: inline;
}
.category-group-courses .search-category span.select2-selection {
  border-radius: 4px 0 0 4px !important;
}
.category-group-courses .dataTables_filter {
  width: calc(100% - 100px) !important;
  float: left;
}
.category-group-courses .dataTables_filter label {
  float: unset;
}
.category-group-courses .container-courses-filters {
  /*display: contents;*/
  width: 100% !important;
}
.category-group-courses .container-courses {
  display: contents;
}
.category-group-courses .container-courses .containercards {
  padding-left: 5px !important;
}
.category-group-courses .view-mode-course {
  float: right;
}
.category-group-courses .view-mode-course i {
  font-size: 14px;
  border: 1px solid #ccc;
  width: 40px;
  height: 33px;
  line-height: 31px;
  display: inline-block;
  text-align: center;
  border-radius: 3px;
  vertical-align: top;
}
.category-group-courses .view-mode-course a:hover i,
.category-group-courses .view-mode-course .toolbar .view-mode a:focus i {
  color: #fff;
  background-color: #0088CC;
  border-color: #0088CC;
  cursor: pointer;
}
.category-group-courses .view-mode-course a.active i,
.category-group-courses .view-mode-course .toolbar .view-mode a.active:focus i {
  color: #fff;
  background-color: #0088CC;
  border-color: #0088CC;
}
.category-group-courses .distrubution-course {
  height: 150px;
  width: 270px;
  margin-bottom: 10px;
  margin-left: 10px;
  margin-right: 15px;
  float: left;
  position: relative;
}
.category-group-courses .distrubution-course .panel-overlay {
  border: 0;
}
.category-group-courses .distrubution-course contacts-course {
  float: right;
  top: 250px;
}
.category-group-courses .distrubution-course .popover {
  top: 0px !important;
  left: 0px !important;
  cursor: initial;
  /*width: 250px !important;*/
}
.category-group-courses .distrubution-course .popover-content {
  max-height: 110px !important;
  overflow-y: auto;
}
.category-group-courses .distrubution-course .panel {
  height: 100%;
}
.category-group-courses .distrubution-course .panel-body {
  height: 100%;
}
.category-group-courses .distrubution-course .backgroundimage {
  margin: 0;
  padding: 0;
  position: absolute;
  top: 0;
  width: 100%;
}
.category-group-courses .spinnerGetMore {
  height: 300px;
}

.container-courses {
  /* NINTH EXAMPLE*/
  /* .view-ninth .content */
}
.container-courses .view {
  height: -webkit-fill-available;
  width: 270px;
  margin-bottom: 10px;
  margin-bottom: 10px;
  margin: 0;
  border: 0;
  border-radius: 4px;
}
.container-courses .view-ninth .mask-1,
.container-courses .view-ninth .mask-2 {
  /*background-color: rgba(0, 0, 0, 0.6);*/
  height: 300px;
  width: 200px;
  /*background: rgba(119, 0, 36, 0.5);*/
  background: rgba(12, 92, 160, 0.5);
  -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=100)";
  filter: alpha(opacity=100);
  transition: all 0.3s ease-in-out 0.6s;
  opacity: 1;
}
.container-courses .view-ninth .mask-1 {
  left: auto;
  right: 0;
  transform: rotate(56.5deg) translateX(-180px);
  transform-origin: 100% 0%;
}
.container-courses .view-ninth .mask-2 {
  top: auto;
  bottom: 0;
  transform: rotate(56.5deg) translateX(180px);
  transform-origin: 0% 100%;
}
.container-courses .view-ninth .content {
  top: -50px;
  height: 0;
  opacity: inherit;
  background-color: rgba(0, 0, 0, 0.6);
  -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=50)";
  filter: alpha(opacity=50);
  overflow: hidden;
  transform: rotate(-33.5deg) translate(-112px, 166px);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.container-courses .view-ninth .content .icon-play {
  width: inherit;
  font-size: 40px;
  color: #FFF;
  margin-top: 10px;
  cursor: pointer;
}
.container-courses .view-ninth .content .txt-start-course {
  width: 100%;
  opacity: unset;
  font-family: unset;
  font-style: normal;
  width: inherit;
  font-size: 12px;
  /*position: absolute;*/
  color: #fff;
  padding: 10px 20px 20px;
  text-align: center;
  font-size: 17px;
  font-weight: bold;
  cursor: pointer;
}
.container-courses .view-ninth .content .container-contact {
  width: 100%;
  position: inherit;
}
.container-courses .view-ninth .content .container-contact .bottom-rigth-option {
  float: right;
  position: absolute;
  top: -30px;
  font-size: 25px;
  color: #FFF;
  cursor: pointer;
}
.container-courses .view-ninth .content .container-contact .popover {
  top: 0 !important;
  left: 0 !important;
  display: block !important;
  z-index: 100000;
}
.container-courses .view-ninth .content .container-contact .popover .popover-content {
  padding: 9px 14px;
  max-height: 70px !important;
  overflow-y: -webkit-paged-y !important;
  width: 230px !important;
}
.container-courses .view-ninth .content2 {
  background-color: rgba(0, 0, 0, 0.6);
  position: absolute;
  height: 60%;
  width: 100%;
  -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=-90)";
  filter: alpha(opacity=90);
  opacity: inherit;
  top: 20%;
  transform: rotate(0) translate(0px, 0px);
  transform-origin: 0% 100%;
  transition: all 0.3s ease-in-out 0.4s;
  font-weight: bold;
  color: #FFF;
}
.container-courses .view-ninth .content2 .tlt-course-name {
  padding-left: 5px;
  padding-right: 5px;
  padding-top: 8px;
  width: 100%;
  /*border-bottom: 1px solid #DADADA;*/
  /*height: 53px !important;*/
  text-align: center;
  align-content: center;
  font-size: 15px;
  min-height: 55px;
}
.container-courses .view-ninth .content2 .progress-course {
  width: 100%;
  display: flex;
  top: -20px;
  position: relative;
}
.container-courses .view-ninth .content2 .progress-course.no-started {
  padding-left: 5px;
  padding-top: 17px;
  font-size: 14px;
}
.container-courses .view-ninth .content2 .progress-course.no-started span {
  width: 100%;
  text-align: center;
}
.container-courses .view-ninth .content2 .progress-course .course-progres-info {
  width: 50px;
  text-align: right;
  display: inline-grid;
  align-content: center;
  padding-left: 5px;
  padding-top: 5px;
  font-size: 14px;
}
.container-courses .view-ninth .content2 .progress-course .course-progres-bar {
  padding-left: 1px !important;
  width: calc(100% - 50px);
}
.container-courses .view-ninth h2 {
  background: transparent;
  margin-top: 5px;
  border-bottom: 1px solid rgba(255, 255, 255, 0.2);
}
.container-courses .view-ninth a.info {
  display: none;
}
.container-courses .view-ninth:hover .content {
  height: 60%;
  width: 100%;
  top: 20%;
  opacity: inherit;
  -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=90)";
  filter: alpha(opacity=90);
  transform: rotate(0deg) translate(0, 0);
}
.container-courses .view-ninth:hover .content2 {
  height: 0;
  -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=-90)";
  filter: alpha(opacity=90);
  opacity: 0.9;
  width: 361px;
  overflow: hidden;
  top: -30px;
  transform: rotate(-33.5deg) translate(-112px, 340px);
}
.container-courses .view-ninth:hover .mask-1,
.container-courses .view-ninth:hover .mask-2 {
  transition-delay: 0s;
}
.container-courses .view-ninth:hover .mask-1 {
  transform: rotate(64deg) translateX(2px);
}
.container-courses .view-ninth:hover .mask-2 {
  /*-webkit-transform: rotate(56.5deg) translateX(-1px);
  -moz-transform: rotate(56.5deg) translateX(-1px);
  -o-transform: rotate(56.5deg) translateX(-1px);
  -ms-transform: rotate(56.5deg) translateX(-1px);
  transform: rotate(56.5deg) translateX(-1px);*/
  transform: rotate(64deg) translateX(-2px);
}

.container-courses .containercards {
  padding-top: 2px !important;
}
.container-courses.cards-in-home .containercards {
  padding-top: 2px !important;
}
.container-courses.cards-in-home .containercards.usedslide {
  position: relative;
}
.container-courses.cards-in-home .containercards ul:first-child {
  width: max-content !important;
}
.container-courses.cards-in-home .containercards .slideControls {
  position: absolute;
  width: calc(100% - 28px);
  bottom: 30px;
}
.container-courses.cards-in-home .containercards .slideControls i {
  font-size: 30px;
}
.container-courses.cards-in-home .containercards .slideControls .slideNext {
  right: 0;
  position: absolute;
  cursor: pointer;
}
.container-courses.cards-in-home .containercards .slideControls .slidePrev {
  left: 0;
  position: absolute;
  cursor: pointer;
}

/*Fix for empty*/
.ul-courses-cards {
  min-height: 200px;
}

.cards-awards,
.cards-course {
  display: block;
}
.cards-awards.default-box,
.cards-course.default-box {
  height: calc(100% - 35px);
  border-style: dashed;
  border-width: 1px;
  border-color: #000;
  min-height: 200px;
}
.cards-awards.default-box #inner-box,
.cards-course.default-box #inner-box {
  bottom: 48px;
  position: absolute;
}
.cards-awards .panel-overlay,
.cards-course .panel-overlay {
  border-radius: 0;
  border: 1px solid #000 !important;
  /*@media only screen and (max-width: 1200px) {
      .img-responsive {
          border-radius: 0;
          width: 100% !important;
          height: 130px !important;
      }
  }*/
}
.cards-awards .panel-overlay .panel-body,
.cards-course .panel-overlay .panel-body {
  overflow: hidden;
  border-radius: 0;
}
.cards-awards .panel-overlay .img-responsive,
.cards-course .panel-overlay .img-responsive {
  border-radius: 0;
  width: 100% !important;
  height: 200px !important;
}
.cards-awards .panel-overlay .img-badges,
.cards-course .panel-overlay .img-badges {
  max-height: 200px !important;
  width: auto !important;
  height: auto !important;
}
@media only screen and (max-width: 1600px) {
  .cards-awards .panel-overlay .img-responsive,
  .cards-course .panel-overlay .img-responsive {
    border-radius: 0;
    width: 100% !important;
    height: 180px !important;
  }
}
@media only screen and (max-width: 1400px) {
  .cards-awards .panel-overlay .img-responsive,
  .cards-course .panel-overlay .img-responsive {
    border-radius: 0;
    width: 100% !important;
    height: 130px !important;
  }
}
@media only screen and (max-width: 991px) {
  .cards-awards .panel-overlay .img-responsive,
  .cards-course .panel-overlay .img-responsive {
    border-radius: 0;
    width: 100% !important;
    height: 200px !important;
  }
}
.cards-awards .panel-overlay .action-award-cards,
.cards-awards .panel-overlay .action-course-cards,
.cards-course .panel-overlay .action-award-cards,
.cards-course .panel-overlay .action-course-cards {
  background: #000;
  height: 100%;
  width: 40px;
  right: 0;
  top: 0;
  padding-top: 20px;
  position: absolute;
  overflow: hidden;
  transform: rotate(0) translate(45px, 0);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.cards-awards .panel-overlay .action-award-cards div,
.cards-awards .panel-overlay .action-course-cards div,
.cards-course .panel-overlay .action-award-cards div,
.cards-course .panel-overlay .action-course-cards div {
  width: 100%;
  text-align: center;
  margin-bottom: 5px;
}
.cards-awards .panel-overlay .action-award-cards div i,
.cards-awards .panel-overlay .action-course-cards div i,
.cards-course .panel-overlay .action-award-cards div i,
.cards-course .panel-overlay .action-course-cards div i {
  top: 0;
  left: 0;
  position: unset;
  color: #ffffff;
  font-size: 18px;
  cursor: pointer;
}
.cards-awards .panel-overlay .action-award-cards div i:hover,
.cards-awards .panel-overlay .action-course-cards div i:hover,
.cards-course .panel-overlay .action-award-cards div i:hover,
.cards-course .panel-overlay .action-course-cards div i:hover {
  color: #00A1F2;
}
.cards-awards .panel-overlay .action-award-cards div p,
.cards-awards .panel-overlay .action-course-cards div p,
.cards-course .panel-overlay .action-award-cards div p,
.cards-course .panel-overlay .action-course-cards div p {
  /*font-family: $course-cards-font;*/
  font-size: 12px;
  color: #ffffff;
}
.cards-awards .panel-overlay .margin-left,
.cards-course .panel-overlay .margin-left {
  background: #000;
  height: 100%;
  width: 15px;
  left: 0;
  top: 0;
  position: absolute;
  overflow: hidden;
  transform: rotate(0) translate(-20px, 0);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.cards-awards .panel-overlay .margin-top,
.cards-course .panel-overlay .margin-top {
  background: #000;
  height: 15px;
  width: 100%;
  left: 0;
  top: 0;
  position: absolute;
  overflow: hidden;
  transform: rotate(0) translate(0, -20px);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.cards-awards .panel-overlay .print-date,
.cards-course .panel-overlay .print-date {
  width: auto;
  overflow: hidden;
  position: absolute;
  top: 15px;
  left: 0;
  transform: rotate(0) translate(0, 0);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.cards-awards .panel-overlay .print-date span,
.cards-course .panel-overlay .print-date span {
  /*font-family: $course-cards-font;*/
  font-size: 12px;
  line-height: 10px;
  color: #fff;
  padding: 4px;
  background: #000;
  display: block;
}
.cards-awards .panel-overlay .print-date .leyend,
.cards-course .panel-overlay .print-date .leyend {
  padding-bottom: 9px;
  line-height: 5px;
  text-align: center;
}
.cards-awards .panel-overlay .hover-play,
.cards-course .panel-overlay .hover-play {
  width: 100%;
  height: 100%;
  background: rgba(0, 0, 0, 0.3);
  overflow: hidden;
  height: 100%;
  position: absolute;
  top: 0;
  left: 0;
  transform: rotate(0) translate(-100%, -100%);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.cards-awards .panel-overlay .hover-play i,
.cards-course .panel-overlay .hover-play i {
  top: calc(50% - 25px);
  left: calc(50% - 25px);
  font-size: 50px;
  position: absolute;
  color: #000;
  cursor: pointer;
}
.cards-awards .panel-overlay .footer-awards,
.cards-awards .panel-overlay .footer-courses,
.cards-course .panel-overlay .footer-awards,
.cards-course .panel-overlay .footer-courses {
  border-top: 0;
  background: #000;
  height: 50px;
  padding-bottom: 5px;
  border-radius: 0 !important;
  position: relative;
}
.cards-awards .panel-overlay .footer-awards .course-porgress-bar,
.cards-awards .panel-overlay .footer-courses .course-porgress-bar,
.cards-course .panel-overlay .footer-awards .course-porgress-bar,
.cards-course .panel-overlay .footer-courses .course-porgress-bar {
  padding: 0;
  position: absolute;
  overflow: hidden;
  transform: rotate(0) translate(0, 0);
  transform-origin: 0% 100%;
  transition: all 0.4s ease-in-out 0.3s;
}
.cards-awards .panel-overlay .footer-awards .course-porgress-bar .progress,
.cards-awards .panel-overlay .footer-courses .course-porgress-bar .progress,
.cards-course .panel-overlay .footer-awards .course-porgress-bar .progress,
.cards-course .panel-overlay .footer-courses .course-porgress-bar .progress {
  background: #000;
  height: 3px;
  border-radius: 0;
  /*padding: 0 0 25px 0;*/
}
.cards-awards .panel-overlay .footer-awards .course-porgress-bar .progress-half-rounded,
.cards-awards .panel-overlay .footer-courses .course-porgress-bar .progress-half-rounded,
.cards-course .panel-overlay .footer-awards .course-porgress-bar .progress-half-rounded,
.cards-course .panel-overlay .footer-courses .course-porgress-bar .progress-half-rounded {
  height: 3px;
  border-radius: 0;
  padding: 0 0 25px 0;
}
.cards-awards .panel-overlay .footer-awards .tlt-course-name,
.cards-awards .panel-overlay .footer-courses .tlt-course-name,
.cards-course .panel-overlay .footer-awards .tlt-course-name,
.cards-course .panel-overlay .footer-courses .tlt-course-name {
  color: #fff;
  position: absolute;
  padding-left: 5px;
  padding-top: 9px;
  padding-right: 5px;
  /*font-family: $course-cards-font;*/
  font-size: 13px;
  line-height: 15px;
}
.cards-awards .panel-overlay .footer-awards .tlt-course-name .ellip,
.cards-awards .panel-overlay .footer-courses .tlt-course-name .ellip,
.cards-course .panel-overlay .footer-awards .tlt-course-name .ellip,
.cards-course .panel-overlay .footer-courses .tlt-course-name .ellip {
  top: 0 !important;
}
.cards-awards .panel-overlay .footer-awards .tlt-course-name .ellip .ellip-line,
.cards-awards .panel-overlay .footer-courses .tlt-course-name .ellip .ellip-line,
.cards-course .panel-overlay .footer-awards .tlt-course-name .ellip .ellip-line,
.cards-course .panel-overlay .footer-courses .tlt-course-name .ellip .ellip-line {
  top: 3px !important;
}
.cards-awards .panel-overlay:hover,
.cards-course .panel-overlay:hover {
  /*.footer-courses {
      padding-top: 5px;
      height: 60px;

      .tlt-course-name {
          padding-top: 19px;

          font-weight: 500;
      }
  }*/
  /*.panel-body {
      margin-bottom: -10px;
  }*/
}
.cards-awards .panel-overlay:hover .action-award-cards,
.cards-awards .panel-overlay:hover .action-course-cards,
.cards-awards .panel-overlay:hover .margin-left,
.cards-awards .panel-overlay:hover .margin-top,
.cards-awards .panel-overlay:hover .hover-play,
.cards-course .panel-overlay:hover .action-award-cards,
.cards-course .panel-overlay:hover .action-course-cards,
.cards-course .panel-overlay:hover .margin-left,
.cards-course .panel-overlay:hover .margin-top,
.cards-course .panel-overlay:hover .hover-play {
  transform: rotate(0) translate(0, 0);
}
.cards-awards .panel-overlay:hover .course-porgress-bar,
.cards-awards .panel-overlay:hover .print-date,
.cards-course .panel-overlay:hover .course-porgress-bar,
.cards-course .panel-overlay:hover .print-date {
  transform: rotate(0) translate(-100%, 0);
}
.cards-awards .panel-overlay:hover .course-porgress-bar,
.cards-course .panel-overlay:hover .course-porgress-bar {
  visibility: hidden;
}
.cards-awards .popover,
.cards-course .popover {
  top: 0 !important;
  left: -30px !important;
  display: block !important;
  z-index: 100000;
  max-width: 90%;
  left: 20px !important;
}
.cards-awards .popover .popover-content,
.cards-course .popover .popover-content {
  padding: 9px 14px;
  max-height: 150px !important;
  height: auto;
  overflow-y: auto !important;
  width: 100% !important;
}

@media (min-width: 1800px) {
  .cards-awards .panel-overlay .img-responsive.badges {
    width: 360px !important;
    height: 360px !important;
  }
}
@media (min-width: 1200px) {
  .cards-awards .panel-overlay .img-responsive.badges {
    width: 300px !important;
    height: 300px !important;
  }
}
@media (min-width: 900px) {
  .cards-awards .panel-overlay .img-responsive.badges {
    width: 240px !important;
    height: 240px !important;
  }
}
@media (min-width: 600px) {
  .cards-awards .panel-overlay .img-responsive.badges {
    width: 180px !important;
    height: 180px !important;
  }
}
@media (max-width: 599px) {
  .cards-awards .panel-overlay .img-responsive.badges {
    width: 120px !important;
    height: 120px !important;
  }
}
@media (min-width: 1800px) {
  .cards-awards .panel-overlay .img-responsive.certificates {
    max-width: 300px !important;
    height: 220px !important;
    width: auto !important;
  }
}
@media (min-width: 1200px) {
  .cards-awards .panel-overlay .img-responsive.certificates {
    max-width: 290px !important;
    height: 210px !important;
    width: auto !important;
  }
}
@media (min-width: 900px) {
  .cards-awards .panel-overlay .img-responsive.certificates {
    max-width: 280px !important;
    height: 200px !important;
    width: auto !important;
  }
}
@media (min-width: 600px) {
  .cards-awards .panel-overlay .img-responsive.certificates {
    max-width: 270px !important;
    height: 190px !important;
    width: auto !important;
  }
}
@media (max-width: 599px) {
  .cards-awards .panel-overlay .img-responsive.certificates {
    max-width: 260px !important;
    height: 180px !important;
    width: auto !important;
  }
}

.width-fit-content {
  width: fit-content;
}

html.lti body {
  background-image: linear-gradient(to bottom right, #5433FF, #20bdff, #a5fecb);
}
html.lti section, html.lti header {
  background-color: transparent !important;
}
html.lti header.header {
  background: transparent !important;
  border: 0px !important;
}
html.lti header.header .separator {
  display: inline-block;
  height: 100%;
  margin: 0px 25px 0px !important;
  width: 0px !important;
  vertical-align: middle;
}
html.lti header.header .userbox .name {
  color: #000011;
  font-size: 1.3rem;
  line-height: 1.2em;
}
html.lti header.header .userbox .role {
  color: #333;
  font-size: 1.1rem;
  line-height: 1.2em;
}
html.lti header.header .userbox .dropdown-menu {
  background-color: #EEE !important;
}
html.lti body section .inner-wrapper section.content-body {
  padding: 5px 40px !important;
}
html.lti .lti-container {
  color: #ffffff;
  font-size: 25px;
  background-color: transparent;
  padding: 15px;
  text-align: center;
  vertical-align: middle;
}
html.lti .lti-container strong {
  font-weight: 300;
}
html.lti .lti-container .far.fa-leaf {
  font-weight: 300 !important;
  font-size: 30px !important;
}
html.lti body section .inner-wrapper section.content-body .h4, html.lti h4 {
  color: #FFF;
  text-align: center;
}
html.lti body section .inner-wrapper section.content-body dl.dl-horizontal {
  color: #FFF;
  text-align: center !important;
}

.watermark {
  /*img {
      filter: brightness(0.3);
  }*/
}
.watermark .unavailale-contant {
  background: rgba(0, 0, 0, 0.7);
  height: 100%;
  width: 100%;
  position: absolute;
  top: 0;
}
.watermark .unavailale-content2 {
  background: rgba(0, 0, 0, 0.7);
  height: 95%;
  width: 90%;
  position: absolute;
  top: 0;
  left: 15px;
  border-radius: 4px;
  border: 0;
}
.watermark .overlay {
  opacity: 0 !important;
}
.watermark .watermark-title {
  position: absolute;
  color: white;
  text-align: center;
  mix-blend-mode: hard-light;
  top: 45%;
  left: 0;
  width: 100%;
  font-size: 20px;
}
.watermark .watermark-info {
  position: absolute;
  color: white;
  text-align: center;
  mix-blend-mode: hard-light;
  top: 65%;
  left: 20px;
  width: 100%;
  font-size: 20px;
  cursor: pointer !important;
}
.watermark .watermark-info .tooltiphelp {
  visibility: hidden;
  width: 120px;
  background-color: black;
  color: #fff;
  text-align: center;
  border-radius: 6px;
  padding: 10px;
  z-index: 1;
  bottom: 150%;
  left: 50%;
  margin-left: -60px;
  font-size: 13px !important;
}
.watermark .watermark-info .tooltiphelp::after {
  content: "";
  position: absolute;
  top: 100%;
  left: 50%;
  margin-left: -5px;
  border-width: 5px;
  border-style: solid;
  border-color: black transparent transparent transparent;
}
.watermark .watermark-info:hover .tooltiphelp {
  visibility: visible;
}

.cursor-not-alloed {
  cursor: not-allowed;
}

.padded-multi-line {
  display: inline;
  font-size: 13px;
  width: calc(100% - 50px);
}

.hours:not(.uib-increment, .uib-decrement, .uib-time):after,
.minutes:not(.uib-increment, .uib-decrement, .uib-time):after,
.seconds:not(.uib-increment, .uib-decrement, .uib-time, .text-weight-bold):after {
  content: ":";
  padding-left: 5px;
}

.feedback-activity {
  width: 100% !important;
}
.feedback-activity .panel {
  border: 0 !important;
  margin-bottom: 0;
}
.feedback-activity .panel-footer {
  border-radius: 0 0 7px 7px !important;
  border: 0 !important;
}
.feedback-activity .br-7p, .feedback-activity .panel-body {
  border-radius: 7px !important;
  /*background: #cecece !important;*/
}
.feedback-activity .panel-group.panel {
  margin-bottom: 0;
  border-radius: 7px !important;
}

.container-upload-evidence {
  /*padding-top: 20px !important;*/
  padding-bottom: 8px !important;
  display: inline-table;
  padding: 10px 15px;
  border: 2px dashed #ccc;
  border-radius: 20px;
  height: 250px;
  width: 250px;
  font-family: sans-serif;
  display: table-cell;
  vertical-align: middle;
  /*margin-top: 25px;*/
}
.container-upload-evidence .btn-upload-evidence {
  margin-top: 10%;
}

/***************************** Dropzone Styling *****************************/
/**
 * The dnd-list should always have a min-height,
 * otherwise you can't drop to it once it's empty
 */
.advancedDemo .dropzone ul[dnd-list] {
  min-height: 42px;
  margin: 0px;
  padding-left: 0px;
}

.advancedDemo .dropzone li {
  display: block;
}

/**
 * Reduce opacity of elements during the drag operation. This allows the user
 * to see where he is dropping his element, even if the element is huge. The
 * .dndDragging class is automatically set during the drag operation.
 */
.advancedDemo .dropzone .dndDragging {
  opacity: 0.7;
}

/**
 * The dndDraggingSource class will be applied to the source element of a drag
 * operation.
 */
.advancedDemo .dropzone .dndDraggingSource {
  opacity: 0.5;
}

/**
 * An element with .dndPlaceholder class will be added as child of the dnd-list
 * while the user is dragging over it.
 */
.advancedDemo .dropzone .dndPlaceholder {
  background-color: #ddd !important;
  display: block;
  min-height: 42px;
}

.notes-activity {
  background: #cecece;
}
.notes-activity .row-conversation {
  padding: 5px 15px !important;
  margin-top: 6px !important;
  background: #E0E0E0;
  border-color: #878787;
  width: 80%;
  border-radius: 7px;
}
.notes-activity .row-conversation.font-bold {
  font-weight: 700;
  width: 100%;
}
.notes-activity .row-conversation.explication {
  float: right;
  color: #000;
  background: #f5f5f5;
  text-align: right;
  /*&.font-bold {
      text-align: right;
  }*/
}
.notes-activity .row-conversation.feedback {
  color: #fff;
  background: #435f7a;
}
.notes-activity .row-conversation:not(.isStudent).explication {
  float: none;
  color: #fff;
  background: #435f7a;
  text-align: left;
}
.notes-activity .row-conversation:not(.isStudent).feedback {
  float: right;
  color: #000;
  background: #f5f5f5;
  text-align: right;
  /*&.font-bold {
      text-align: right;
  }*/
}

.notes-activity-footer {
  background: #cecece;
}
.notes-activity-footer .inset-comment {
  float: left;
  border: none;
  width: 100%;
}
.notes-activity-footer .inset-comment .counter-comment {
  float: right;
  /*display: none;*/
}
.notes-activity-footer .inset-comment .comment {
  width: 100%;
  padding: 11px 32px 10px 8px;
  resize: none;
  overflow: auto;
  padding: 2px;
  min-height: 60px;
}

.spinnerevidence {
  float: right;
  width: 50px;
  height: 20px;
  text-align: center;
  font-size: 10px;
}

.spinnerevidence > div {
  background-color: #333;
  height: 100%;
  width: 6px;
  display: inline-block;
  animation: sk-stretchdelay 1.2s infinite ease-in-out;
}

.spinnerevidence .rect2 {
  animation-delay: -1.1s;
}

.spinnerevidence .rect3 {
  animation-delay: -1s;
}

.spinnerevidence .rect4 {
  animation-delay: -0.9s;
}

.spinnerevidence .rect5 {
  animation-delay: -0.8s;
}

.activity-content {
  color: #000000;
}
.activity-content h4 {
  color: #000000;
  padding: 10px 16px;
  font-size: 16px;
}

.bulb-yellow {
  color: #FFC21C;
}

.gallery-evidence {
  display: flex;
}
.gallery-evidence ul {
  list-style-type: none;
  padding-left: 15px;
  padding-right: 15px;
  display: flex;
  flex-wrap: wrap;
}
.gallery-evidence ul.listActivityes {
  display: flex;
}
.gallery-evidence ul li {
  position: relative;
  overflow: hidden;
  margin-right: 10px;
}
.gallery-evidence ul li .container-options-act {
  display: flex;
  z-index: 10;
  justify-content: space-between;
  width: 100%;
  padding-top: 8px;
  padding-left: 5px;
}
.gallery-evidence ul li .container-options-act option-evidence {
  justify-content: space-between;
}
.gallery-evidence ul li .mosaicItem {
  width: 250px;
  height: 250px;
  background: #CECECE;
  position: relative;
}
.gallery-evidence ul li .mosaicItem > .container-evidence {
  /*&:hover .text {
      bottom: 0;
      opacity: 1;
  }*/
}
.gallery-evidence ul li .mosaicItem > .container-evidence img {
  max-height: 100%;
  max-width: 100%;
  width: auto;
  height: auto;
  position: absolute;
  top: 0;
  bottom: 0;
  left: 0;
  right: 0;
  margin: auto;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .download {
  position: absolute;
  left: 0;
  top: 0;
  width: 100%;
  height: 100%;
  background: rgba(0, 0, 0, 0.7);
  color: white;
  transition: all 0.5s ease-in-out;
  padding-top: 45%;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text {
  position: absolute;
  bottom: -50px;
  left: 0;
  width: 100%;
  height: 50px;
  background: rgba(0, 0, 0, 0.8);
  color: white;
  transition: all 0.5s ease-in-out;
  opacity: 0;
  /*span {
      float: right;
      margin-top: 10px;
      height: 45px;
  }

  span:nth-child(1) {
      &:not(.review) {
          width: 10px;
          margin-right: 15px;
          margin-left: 5px;
          display: inline-flex;
          color: #ff0606;
      }

      &.review {
          color: #0088CC;
          margin-right: 20px;
      }
  }

  span:nth-child(2) {
      width: 10px;
      margin-right: 10px;
      margin-left: 5px;
      display: inline-flex;
      color: #0088CC;

      &.review {
          float: left;
          margin: 6px 0px;
          padding-left: 5px;
          padding-right: 5px;
          width: calc(100% - 40px);
          display: inline-flex;
          display: inline-block;
          position: absolute;
          vertical-align: middle;
          line-height: normal;
      }
  }



  span:nth-child(3) {
      float: left;
      margin: 6px 0px;
      padding-left: 5px;
      width: calc(100% - 50px);
      display: inline-flex;
      display: inline-block;
      position: absolute;
      vertical-align: middle;
      line-height: normal;
  }*/
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .option-evidence-r {
  width: 20px;
  text-align: center;
  margin-right: 10px;
  height: 50px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .option-evidence-r span {
  vertical-align: middle;
  line-height: normal;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .name-evidence-r {
  color: #fff;
  width: 220px;
  padding-left: 5px;
  padding-right: 5px;
  height: 50px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .name-evidence-r span {
  vertical-align: middle;
  line-height: normal;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .option-evidence {
  /*width: 25px;*/
  text-align: center;
  color: #ff0606;
  height: 20px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
  padding-right: 5px;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .option-evidence span {
  vertical-align: middle;
  line-height: normal;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .option-evidence.down {
  color: #0088CC;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .name-evidence {
  color: #fff;
  width: 200px;
  padding-left: 5px;
  padding-right: 5px;
  top: 0;
  height: 50px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
}
.gallery-evidence ul li .mosaicItem > .container-evidence .text .name-evidence span {
  vertical-align: middle;
  line-height: normal;
}
.gallery-evidence ul li .mosaicItem:hover .container-evidence .text {
  bottom: 0;
  opacity: 1;
}
.gallery-evidence ul li .h-21 {
  height: 21px;
  width: 100%;
}

.review-panel .panel-heading-review {
  padding: 0 !important;
}
.review-panel .panel-heading:not(.note-toolbar) {
  padding: 0 !important;
}
.review-panel .mr-all {
  margin-right: -15px;
}

.status-activity {
  padding: 0;
}
.status-activity h4 {
  padding: 5px 16px;
}
.status-activity .in-progress {
  background: rgba(237, 156, 40, 0.25);
  width: 100%;
  display: inline-flex;
}
.status-activity .in-submit {
  background: rgba(0, 136, 204, 0.25) !important;
}
.status-activity .in-complete {
  background: rgba(71, 164, 71, 0.25) !important;
}

.review-panel .panel-heading {
  border-bottom: 0;
}

.custom-checked {
  display: inline-flex;
  padding: 0;
}
.custom-checked .badgebox {
  opacity: 0;
}
.custom-checked .badgebox + .badge {
  /* Move the check mark away when unchecked */
  text-indent: -999999px;
  /* Makes the badge's width stay the same checked and unchecked */
  width: 27px;
}
.custom-checked .badgebox:focus + .badge {
  /* Set something to make the badge looks focused */
  /* This really depends on the application, in my case it was: */
  /* Adding a light border */
  box-shadow: inset 0px 0px 5px;
  /* Taking the difference out of the padding */
}
.custom-checked .badgebox:checked + .badge {
  /* Move the check mark back when checked */
  text-indent: 0;
}

.rounded-return {
  border-radius: 25px 0px 0px 25px;
}

.student-panel .userway {
  top: 2px !important;
  right: 8px !important;
}

.panel#course-cards {
  border: none;
}
.panel#course-cards .panel-heading {
  border-bottom: 2px solid #DADADA;
  padding-bottom: 25px;
}
.panel#course-cards .panel-heading, .panel#course-cards .panel-body {
  background: transparent;
}
.panel#course-cards .panel-title {
  font-size: 21px;
  font-weight: 700;
}
.panel#course-cards .panel-buttons {
  width: 70%;
}
.panel#course-cards .panel-buttons .btn-default.search {
  border-left: 0;
  color: #DDD;
}
.panel#course-cards .panel-buttons .btn-default.search:hover {
  color: #FFF;
}

section .panel-courses {
  border-radius: 10px 10px 0 0;
}

.title-category {
  font-size: 18px;
  font-weight: 700;
  color: #000000;
  margin-top: 20px;
  margin-bottom: 10px;
}

.cards-course .section-landing {
  border: 0 !important;
}
.cards-course .section-landing .panel-body {
  padding: 0;
}
.cards-course .section-landing .panel-body .course-card {
  border-radius: 10px 10px 0 0;
}
.cards-course .section-landing .panel-body .label-card {
  position: absolute;
  top: 1.5em;
  right: 0px;
  font-size: 10px;
  align-content: center;
  padding: 5px 10px;
  border-radius: 5px 0 0 5px;
  font-weight: 100;
}
.cards-course .section-landing .panel-body .label-card .leyend-vistited {
  padding-right: 10px;
}
.cards-course .section-landing .hide-element {
  visibility: hidden;
}
.cards-course .section-landing .footer-courses-cards {
  background: #FFFFFF;
  border-radius: 0 0 10px 10px !important;
  padding: 0 12px !important;
}
.cards-course .section-landing .footer-courses-cards .title-course {
  margin: 12px 0;
  height: 80px;
  overflow: hidden;
  text-overflow: ellipsis;
  -webkit-line-clamp: 2;
  display: -webkit-box;
  -webkit-box-orient: vertical;
  white-space: normal;
  /*                background: #4492f4;*/
}
.cards-course .section-landing .footer-courses-cards .title-course p {
  font-size: 14px;
  font-weight: 700;
  color: #23262B;
}
.cards-course .section-landing .footer-courses-cards .title-course p.extra-information {
  font-size: 11px !important;
}
.cards-course .section-landing .footer-courses-cards .container-progress-bar {
  width: 90%;
  height: 10px;
}
.cards-course .section-landing .footer-courses-cards .progress {
  box-shadow: unset !important;
  background: #d3d4d5;
}
.cards-course .section-landing .footer-courses-cards .progress-xs {
  height: 6px !important;
}
.cards-course .section-landing .footer-courses-cards .icon-play, .cards-course .section-landing .footer-courses-cards .fa-question-circle {
  font-size: 16px;
}
.cards-course .section-landing .footer-courses-cards .fa-question-circle {
  color: #23262B;
  opacity: 0.52;
  font-weight: 700;
}
.cards-course .section-landing .footer-courses-cards .view-progress {
  color: #23262B;
  opacity: 0.6;
  font-weight: 700;
  float: right;
}
.cards-course .section-landing .footer-courses-cards .options-in-card {
  padding: 10px 0;
  margin-right: 18px;
}
.cards-course .section-landing .footer-courses-cards .options-in-card .opt-contacts {
  width: 30px;
}
.cards-course .section-landing .footer-courses-cards .options-in-card .opt-start-course {
  width: calc(100% - 30px);
}
.cards-course .section-landing .footer-courses-cards .options-in-card .opt-start-course .separator-r {
  margin-right: 12px;
}

.btn-view-type {
  padding: 6px !important;
  width: 32px;
  height: 32px;
}

.margin-order-filters {
  margin-top: 20px;
}

.courses-home-filter-search {
  display: flex;
  flex-direction: row;
  justify-content: flex-end;
}
.courses-home-filter-search .courses-filter-item {
  width: 280px;
}
.courses-home-filter-search .courses-filter-item.courses-filter-category {
  padding-right: 20px;
}
.courses-home-filter-search .courses-filter-item.courses-filter-category .selectize-control .selectize-input {
  color: #555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 4px;
}
.courses-home-filter-search .courses-filter-item.courses-filter-category .selectize-control .selectize-input input {
  width: 175.117px;
  opacity: 1;
  position: absolute;
  left: 11px;
  padding-top: 7px;
  margin-top: 7px;
  top: 8px;
  font-size: 14px;
  color: #555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 4px;
}
.courses-home-filter-search .course-filter-form-control {
  display: flex;
  flex-direction: row;
  flex-flow: wrap;
}
.courses-home-filter-search .leyend-order {
  color: #23262B;
  font-size: 12px;
  margin-top: 8px;
  font-weight: 700;
}

@media (min-width: 953px) and (max-width: 1127px) {
  .cards-course {
    width: 50% !important;
  }
}
@media (max-width: 985px) {
  .resp-data {
    width: 100% !important;
    display: flow-root;
    float: none;
    margin-top: 10px;
  }
}
.course-spinner {
  position: fixed;
  top: 0;
  left: 0;
  bottom: 0;
  right: 0;
  background: #474747;
  z-index: 9999;
  opacity: 0.8;
}
.course-spinner .text {
  color: white;
  /*width: 50%;*/
  font-size: 2rem;
  transform: translate(-50%, -50%);
  position: absolute;
  top: 50%;
  left: 50%;
  padding: 20px;
  resize: both;
  /*overflow: auto;*/
}

.course-html {
  min-height: 100%;
  height: 100vh;
  overflow-y: scroll !important;
  padding-bottom: 80px !important;
}

.dragFile .container-upload-evidence {
  background: #FAEBD7;
}

.main-preview-evidence {
  display: flex;
  flex-direction: row;
  justify-content: center;
  align-items: center;
  flex-wrap: wrap;
  width: 100% !important;
}
.main-preview-evidence .vjs-video-wrap {
  width: 80%;
  word-wrap: normal;
  height: 350px;
  position: relative;
}
.main-preview-evidence .vjs-video-wrap .vjs-tech {
  padding: 0 30px;
}

.modal-preview-evidence .modal-dialog {
  padding-top: calc(22% - 300px);
}
.modal-preview-evidence .btn-close-modal {
  position: absolute;
  top: 5px;
  right: 5px;
  background: transparent;
  /*color: #000;*/
}
.modal-preview-evidence .btn-close-modal:active {
  box-shadow: unset;
}

.mosaicItem .video-js {
  background: transparent;
}

/*actividades*/
.modal-preview-evidence .mosaicItem {
  width: 550px;
  height: 450px;
  background: #CECECE;
  position: relative;
}
.modal-preview-evidence .mosaicItem > .container-evidence img {
  max-height: 100%;
  max-width: 100%;
  width: auto;
  height: auto;
  position: absolute;
  top: 0;
  bottom: 0;
  left: 0;
  right: 0;
  margin: auto;
}
.modal-preview-evidence .mosaicItem > .container-evidence .download {
  position: absolute;
  left: 0;
  top: 0;
  width: 100%;
  height: 100%;
  background: rgba(0, 0, 0, 0.7);
  color: white;
  transition: all 0.5s ease-in-out;
  padding-top: 45%;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text {
  position: absolute;
  bottom: -50px;
  left: 0;
  width: 100%;
  height: 50px;
  background: rgba(0, 0, 0, 0.8);
  color: white;
  transition: all 0.5s ease-in-out;
  opacity: 0;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .option-evidence-r {
  width: 20px;
  text-align: center;
  margin-right: 10px;
  height: 50px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .option-evidence-r span {
  vertical-align: middle;
  line-height: normal;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .name-evidence-r {
  color: #fff;
  width: 220px;
  padding-left: 5px;
  padding-right: 5px;
  height: 50px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .name-evidence-r span {
  vertical-align: middle;
  line-height: normal;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .option-evidence {
  width: 25px;
  text-align: center;
  color: #ff0606;
  height: 20px;
  display: table-cell;
  vertical-align: middle;
  position: relative;
  padding-right: 5px;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .option-evidence span {
  vertical-align: middle;
  line-height: normal;
}
.modal-preview-evidence .mosaicItem > .container-evidence .text .option-evidence.down {
  color: #0088CC;
}
.modal-preview-evidence .mosaicItem:hover .container-evidence .text {
  bottom: 0;
  opacity: 1;
}

.lectures .sample-files {
  background-color: #f2f2f2;
  margin-left: -20px !important;
  margin-right: -20px !important;
}
.lectures .sample-files .element-details {
  border-bottom: none !important;
  border-right: solid #fff 1px !important;
  padding-right: 10px;
  padding-left: 10px;
}
.lectures .sample-files .element-details:first-child {
  padding-left: 0px;
}
.lectures .sample-files .element-details:last-child {
  border-right: none !important;
}

.section-element .uploads-tabs ul:not(.uploads-tabs):not(.pagination):not(.dropdown-menu) {
  padding: 0 !important;
  margin-left: 0 !important;
  margin-right: 0 !important;
}
.section-element .uploads-tabs .tab-content {
  min-height: 100px;
}

.cards-courses {
  display: flex;
  flex-wrap: wrap;
}
.cards-courses .row {
  width: 100%;
}

.video-brightcove {
  width: 100% !important;
}
.video-brightcove video {
  position: initial !important;
}
.video-brightcove .vjs-mouse .vjs-progress-control {
  top: -1em !important;
}

.article-content {
  max-height: 90%;
  overflow: auto;
  background: #fff;
}
.article-content .panel-body {
  min-height: 50vh;
  padding-top: 10vh;
}

.cursor-default {
  cursor: default !important;
}

.course-objectives {
  padding: 10px;
}
.course-objectives:nth-child(odd) {
  background-color: #f0f0f0;
}
.course-objectives:nth-child(even) {
  background-color: #e6e6e6;
}
.course-objectives .dd-handle {
  display: flex;
  width: 100%;
  align-items: center;
  justify-content: space-between;
  padding-left: unset;
}
.course-objectives .dd-handle > .objective-text {
  display: flex;
  align-items: center;
  width: inherit;
}
.course-objectives .dd-handle > .objective-text .label-objective {
  margin-right: 8px;
  padding-left: 8px;
}
.course-objectives .dd-handle > .options {
  align-self: flex-end;
}
.course-objectives .input-text {
  /*display: none;*/
  display: block !important;
  width: 100%;
}
.course-objectives .options {
  display: flex;
  height: 100%;
  align-items: center;
}
.course-objectives .options button {
  background: none;
  border: none;
  padding: 0;
  margin: 0 10px;
  cursor: pointer;
}
.course-objectives .options button span {
  display: inline-block;
  transition: transform 0.2s ease-in-out;
}
.course-objectives .options button span i {
  font-size: 17px;
}
.course-objectives .options button:hover span {
  transform: scale(1.3);
}

.cim-nbr-assessments {
  background: #646464;
  border-radius: 3px;
  width: 90px;
}

.cim-nbr-passed {
  background: #5C8825;
  border-radius: 3px;
  width: 90px;
}

.cim-nbr-needs-work {
  background: #d2322d;
  border-radius: 3px;
  width: 90px;
}

.cim-nbr-submited {
  background: #FFC000;
  border-radius: 3px;
  width: 90px;
}

.crs-session .elements-course-dashboard-sections-container.active-report-course {
  background: #ffffff;
}

.body-instructions-class {
  font-size: 18px;
  font-weight: 500;
  margin-top: 10px;
}

.translateCourse table tbody tr:hover {
  background-color: rgba(80, 120, 55, 0.2);
}
.translateCourse .view-last-content {
  background-color: rgba(0, 0, 0, 0.15);
}

.display-flex {
  display: flex;
}
.display-flex .container-languages {
  padding-right: 15px;
  margin-right: 15px;
  border-right: 1px solid #000;
}
.display-flex .mr-lang {
  padding-right: 5px;
}

.course-student-resources {
  display: flex;
  margin: 1em 0;
  width: 100%;
  justify-content: center;
}
.course-student-resources p {
  margin-bottom: 0.5em;
  font-weight: bold;
  font-size: 16px;
}
.course-student-resources .resource-list {
  list-style: decimal inside;
  padding-left: 0;
  margin: 0;
  font-size: 14px;
  text-decoration: underline;
}
.course-student-resources .resource-list .resource-item {
  display: flex;
  align-items: center;
  padding: 4px 0;
}

.notify-alert {
  background: rgba(0, 0, 0, 0.6) !important;
  color: white !important;
  border-color: rgba(0, 0, 0, 0.6) !important;
  border: 0px !important;
  margin-bottom: 15px !important;
  padding: 10px !important;
}

.floating-index-alert {
  position: fixed;
  z-index: 1;
  margin-top: 60px;
  width: 100%;
}
.floating-index-alert .alert {
  border-radius: 0px !important;
}

.alert-admin-info {
  padding: 7px;
}

/*SASS CODE FOR NOTIFICATIONS ADMINISTRATION*/
.notifications > li .notification-icon {
  width: 25px;
  height: 25px;
  background: none !important;
  border-radius: 0 !important;
  box-shadow: none !important;
}
.notifications > li .notification-icon i {
  color: #666 !important;
}
.notifications > li .notification-icon .notification-circle {
  height: 7px;
  width: 7px;
  background-color: red;
  border-radius: 50%;
  top: 2px;
  right: -2px;
  position: absolute;
}
.notifications > li .notification-icon .far {
  line-height: 25px;
  font-size: 1.6em;
}

.notifications .notification-menu:before {
  border-bottom-color: #fff !important;
  right: 25px;
}
.notifications .notification-menu {
  width: 500px;
  margin: 5px -11px 0 0 !important;
  box-shadow: 3px 3px 3px 3px rgba(0, 0, 0, 0.3);
}
.notifications .notification-menu .message {
  color: #333;
  display: block;
  font-size: 1.1rem;
  line-height: 1.5rem;
  padding: 0;
}
.notifications .notification-menu .title {
  color: #000011;
  display: block;
  font-size: 1.2rem;
  line-height: 1.7rem;
  padding: 2px 0 0;
}
.notifications .notification-menu .label-default {
  background: #fff;
  color: #777;
}
.notifications .notification-menu .label-roles {
  background: #fff !important;
  color: #000 !important;
  border-style: solid !important;
  border-width: thin !important;
}
.notifications .notification-menu li {
  border-bottom: none;
  padding: 5px;
  margin: 0px;
}
.notifications .notification-menu li label {
  background: #fff;
  color: #777;
}
.notifications .notification-menu li.unread {
  background: #F4F4F4 !important;
}
.notifications .notification-menu li.read {
  background: #DCEFDC !important;
}
.notifications .notification-menu li.first {
  border-radius: 15px 15px 0px 0px;
}
.notifications .notification-menu li.last {
  border-radius: 0px 0px 15px 15px;
}
.notifications .notification-menu li.both {
  border-radius: 15px 15px 15px 15px;
}
.notifications .notification-menu .label-default {
  background: #777;
  color: #fff;
}

.notification-menu {
  width: 50%;
  margin: 0 auto;
  border-radius: 15px;
}

/*Estilos para el preview de las notificaciones*/
/* ui-pnotify-container */
.notification-default:not(.ui-pnotify-container) {
  width: 40px !important;
  height: 40px !important;
  line-height: 40px !important;
  font-size: 20px !important;
  text-align: center;
  display: inline-block;
  background-color: #bdbdbd;
  border-radius: 25px;
}

.notification-primary:not(.ui-pnotify-container) {
  width: 40px !important;
  height: 40px !important;
  line-height: 40px !important;
  font-size: 20px !important;
  text-align: center;
  display: inline-block;
  background-color: #0088cc;
  border-color: #0088cc;
  border-radius: 25px;
}

.notification-success:not(.ui-pnotify-container) {
  width: 40px !important;
  height: 40px !important;
  line-height: 40px !important;
  font-size: 20px !important;
  text-align: center;
  display: inline-block;
  background-color: #47a447;
  border-color: #47a447;
  border-radius: 25px;
}

.notification-info:not(.ui-pnotify-container) {
  width: 40px !important;
  height: 40px !important;
  line-height: 40px !important;
  font-size: 20px !important;
  text-align: center;
  display: inline-block;
  background-color: #5bc0de;
  border-color: #5bc0de;
  border-radius: 25px;
}

.notification-warning:not(.ui-pnotify-container) {
  width: 40px !important;
  height: 40px !important;
  line-height: 40px !important;
  font-size: 20px !important;
  text-align: center;
  display: inline-block;
  background-color: #ed9c28;
  border-color: #ed9c28;
  border-radius: 25px;
}

.notification-danger:not(.ui-pnotify-container) {
  width: 40px !important;
  height: 40px !important;
  line-height: 40px !important;
  font-size: 20px !important;
  text-align: center;
  display: inline-block;
  background-color: #d2322d;
  border-color: #d2322d;
  border-radius: 25px;
}

div.to-collapse {
  border-color: rgba(0, 0, 0, 0.3);
  border-style: solid;
  border-width: thin;
  border-top-width: 0px;
}

div.alerts-body a:hover {
  background-color: transparent !important;
}
div.alerts-body a:focus {
  background-color: transparent !important;
}

.ring-bell {
  -webkit-animation: ring 4s 0.7s ease-in-out infinite;
  -webkit-transform-origin: 50% 4px;
  -moz-animation: ring 4s 0.7s ease-in-out infinite;
  -moz-transform-origin: 50% 4px;
  animation: ring 4s 0.7s ease-in-out infinite;
  transform-origin: 50% 4px;
}
@keyframes ring {
  0% {
    transform: rotate(0);
  }
  1% {
    transform: rotate(30deg);
  }
  3% {
    transform: rotate(-28deg);
  }
  5% {
    transform: rotate(34deg);
  }
  7% {
    transform: rotate(-32deg);
  }
  9% {
    transform: rotate(30deg);
  }
  11% {
    transform: rotate(-28deg);
  }
  13% {
    transform: rotate(26deg);
  }
  15% {
    transform: rotate(-24deg);
  }
  17% {
    transform: rotate(22deg);
  }
  19% {
    transform: rotate(-20deg);
  }
  21% {
    transform: rotate(18deg);
  }
  23% {
    transform: rotate(-16deg);
  }
  25% {
    transform: rotate(14deg);
  }
  27% {
    transform: rotate(-12deg);
  }
  29% {
    transform: rotate(10deg);
  }
  31% {
    transform: rotate(-8deg);
  }
  33% {
    transform: rotate(6deg);
  }
  35% {
    transform: rotate(-4deg);
  }
  37% {
    transform: rotate(2deg);
  }
  39% {
    transform: rotate(-1deg);
  }
  41% {
    transform: rotate(1deg);
  }
  43% {
    transform: rotate(0);
  }
  100% {
    transform: rotate(0);
  }
}
.userbox .profile-picture img {
  width: 30px !important;
  height: 30px !important;
}

.jconfirm-content {
  font-size: 16px !important;
}

.notification-header {
  padding: 5px 15px;
  border-radius: 8px 8px 0 0;
}

.notification-header-empty {
  padding: 5px 15px;
  border-radius: 8px 8px 8px 8px;
}

div.alerts-body a:hover {
  background-color: transparent !important;
  color: #fff !important;
}

div.alerts-body a:focus {
  background-color: transparent !important;
  color: #fff !important;
}

#floating-filters {
  background: #171717;
  bottom: 0;
  min-height: 100vh;
  position: absolute;
  right: 0;
  top: 0;
  width: 300px;
}

/* Create Award */
.panel-create-award .label-container {
  display: inline-block;
  margin-bottom: 5px;
}
.panel-create-award .labels-info {
  padding-right: 5px;
  cursor: pointer;
}
.panel-create-award .labels-info + .texts, .panel-create-award .labels-info + div + .texts {
  border: 1px solid #cecece;
  padding: 2px 5px;
  border-radius: 4px;
}

/* Gallery Awards*/
.img-award-overlay {
  background: rgba(0, 0, 0, 0.75);
  text-align: center;
  opacity: 0.5;
  width: 100%;
  z-index: 1;
  height: 100%;
  position: absolute;
}
.img-award-overlay .icon-content {
  color: #fff;
  position: relative;
  top: 40%;
  font-size: 3rem;
}

.img-award-gray {
  filter: grayscale(100%);
  cursor: default;
}

.awards-table-details td {
  text-align: center;
  vertical-align: middle !important;
  padding: 5px;
  position: relative;
}
.awards-table-details td.subtable {
  padding: 0 !important;
  text-align: left;
}
.awards-table-details td img {
  width: 180px;
  vertical-align: middle;
  display: inline-block;
}
.awards-table-details td .text-content {
  display: inline-block;
  vertical-align: middle;
}

.dotted-coupon-div {
  border: 1px dashed #000;
  border-radius: 4px;
  min-height: 206px !important;
  display: inline;
}
.dotted-coupon-div p {
  margin: 0 auto;
  margin-top: 60px;
}
.dotted-coupon-div #inner-box {
  background: rgba(39, 42, 43, 0.6);
  height: 100%;
  width: 100%;
  opacity: 0;
  top: 0;
  left: 0;
  position: absolute;
  padding: 0;
  transition: opacity 0.5s;
}
.dotted-coupon-div #inner-box p {
  color: #fff;
  text-align: center;
  padding: 10px;
  font-size: 16px;
}
.dotted-coupon-div:hover #inner-box {
  opacity: 1;
  transition: opacity 0.5s;
}

#lightSlider li {
  width: 17%;
}
#lightSlider li a section {
  border: 1px solid #ABB2B9 !important;
}
#lightSlider li .empty-li {
  border: 2px dashed #000;
  min-height: 260px !important;
}
#lightSlider li .overlay {
  display: flex;
  justify-content: center;
  align-items: center;
  position: absolute;
  z-index: 2;
  transition: opacity 200ms ease-in-out;
  border-radius: 4px;
  width: 100% !important;
  height: 100% !important;
  background-color: rgba(39, 42, 43, 0.6);
  opacity: inherit;
}
#lightSlider li .play {
  visibility: hidden;
}
#lightSlider li .play h4 {
  color: white;
}
#lightSlider li .header-texts {
  padding-right: 5px;
  padding-left: 5px;
  position: absolute;
  top: 10px;
  left: 10px;
}
#lightSlider li .header-texts .text-clamp.text-clamp.line-clamp-two {
  -webkit-line-clamp: 2;
  height: 6rem !important;
}
#lightSlider li .overlay:hover .play {
  opacity: 1 !important;
  display: flex;
  justify-content: center;
  align-items: center;
  position: absolute;
  z-index: 2;
  background: #212F3D;
  transition: opacity 200ms ease-in-out;
  border-radius: 4px;
  width: 100% !important;
  height: 100% !important;
  visibility: visible;
}
#lightSlider li .overlay:hover .play #content-text {
  visibility: hidden;
}
#lightSlider li .left-div:after {
  content: "";
  background-color: #000;
  position: absolute;
  width: 1px;
  height: 55px;
  top: 10px;
  left: 100%;
  display: block;
}
#lightSlider li .li-courses section .panel-body {
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
  border-bottom-right-radius: 0px !important;
  border-bottom-left-radius: 0px !important;
}
#lightSlider li .li-test .section .panel-heading {
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
  border-bottom-right-radius: 0px !important;
  border-bottom-left-radius: 0px !important;
}
#lightSlider .h-130-px {
  height: 130px !important;
}
#lightSlider .courses-title {
  top: 10px;
  left: 10px;
  position: absolute;
}
#lightSlider div.parent {
  position: relative;
}
#lightSlider div.relative {
  position: relative;
  width: 100%;
  bottom: 5px;
}

.separate-by-border-right {
  border-right: 1px solid black;
  border-collapse: separate;
}

.upper-left-corner {
  top: 0px !important;
  left: 0px !important;
}

.header-texts h2 {
  text-shadow: 3px 3px 5px black;
}

.white-chevron {
  text-shadow: 1px 1px 30px #fff;
}

/*Pastel Background Colors*/
.pastel-color-blue {
  background-color: #bae1ff;
}

.skillify-card {
  padding-bottom: 15px;
  display: flex;
  flex-direction: row;
}
.skillify-card .hide-element {
  visibility: hidden;
}
.skillify-card .course-details {
  width: 100%;
  display: flex;
  flex-direction: column;
  padding-left: 20px;
}
.skillify-card .course-details .course-details-name {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
}
.skillify-card .course-details .course-details-information {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
}
.skillify-card .course-details .course-details-progress {
  display: flex;
  flex-direction: row;
  justify-content: flex-end;
}
.skillify-card .course-details .course-details-progress .total-grade {
  margin-top: 10px;
}
.skillify-card .course-details .course-details-progress .progress-element {
  width: 100%;
  padding-right: 20px;
}
.skillify-card .course-details .course-details-progress .progress-element .progress {
  height: 6px !important;
  background-color: #C4C6C9 !important;
  margin-top: 15px;
  box-shadow: none !important;
  margin-bottom: 0px;
}
.skillify-card .course-details .course-details-progress .button-continue {
  padding-left: 20px;
  width: 200px;
}
@media (max-width: 767px) {
  .skillify-card .course-details .course-details-progress .button-continue {
    width: 100px;
  }
}
.skillify-card w-auto {
  width: auto !important;
}
.skillify-card img {
  width: 180px;
  height: 100px;
  border-radius: 4px;
  float: right;
}
.skillify-card p {
  font-weight: bold;
}
.skillify-card h4 {
  margin-top: 0px !important;
}

.scenarios-launch {
  display: flex;
  flex-flow: row wrap;
}
.scenarios-launch .scenarios-empty {
  padding-bottom: 10px;
}
.scenarios-launch .scenarios-options {
  padding-bottom: 10px;
}

.scenarios-block {
  display: block;
}
.scenarios-block .playlist-container {
  width: 100% !important;
  min-width: 100px !important;
  max-height: 100px !important;
}
.scenarios-block .add-container {
  display: block;
  position: relative;
  width: 100%;
}
.scenarios-block .add-container.no-display {
  display: none;
}
.scenarios-block .add-container.inline-block {
  display: inline-block;
  padding: 30px;
}
.scenarios-block .add-container .add-content {
  width: 100%;
  position: relative;
}
.scenarios-block .add-container .add-content .add-bar-position {
  position: absolute;
  top: -15px;
  left: 0;
  width: 100%;
  height: 30px;
  cursor: pointer;
  visibility: visible;
  transition: opacity 0.15s ease-in-out;
}
.scenarios-block .add-container .add-content .add-bar-position .add-button-plus:hover {
  background: #101824;
  border-color: hsla(0, 0%, 100%, 0.3);
}
.scenarios-block .add-container .add-content .add-bar-position .add-button-plus:hover:after, .scenarios-block .add-container .add-content .add-bar-position .add-button-plus:hover:before {
  background: #fff;
}
.scenarios-block .add-container .add-content .add-bar-position .add-button-plus:hover.button-content, .scenarios-block .add-container .add-content .add-bar-position .add-button-plus:hover.button-section {
  color: #fff;
}
.scenarios-block .add-container .add-content .add-bar-container {
  position: relative;
  top: 15px;
  width: 100%;
  display: block;
}
.scenarios-block .add-container .add-content .add-bar-container .add-bar {
  display: block;
  width: 100%;
  position: relative;
}
.scenarios-block .add-container .add-content .add-bar-container .border-left,
.scenarios-block .add-container .add-content .add-bar-container .border-rigth {
  position: absolute;
  top: 50%;
  left: 0;
  width: calc(50% - 100px);
  height: 0;
  border-top: 1px dashed hsla(0, 0%, 100%, 0.3);
  border-bottom: 1px dashed rgba(0, 0, 0, 0.3);
  transition: opacity 0.15s ease-in-out;
  border-bottom-color: rgba(0, 0, 0, 0.3);
}
.scenarios-block .add-container .add-content .add-bar-container .border-rigth {
  left: auto;
  right: 0;
}
.scenarios-block .add-container .add-content .add-bar-container .add-button-position {
  position: absolute;
  top: -13px;
  left: calc(50% - 90px);
  margin-left: -10px;
  width: 200px;
  height: 28px;
}
.scenarios-block .add-container .content-container {
  display: inline-block;
  width: 100%;
  text-align: center;
  height: 0;
}
.scenarios-block .add-container .content-container .content-files {
  display: inline-block;
  background: rgba(245, 249, 252, 0.25);
  overflow: hidden;
  visibility: hidden;
  width: 85%;
  height: 0;
  opacity: 0;
  filter: alpha(opacity=0);
  border-radius: 3px;
  transition: all 0.2s ease-in-out;
  box-shadow: 0 0 13px 0 rgba(22, 45, 61, 0.2);
}
.scenarios-block .add-container .content-container .content-files .content-files-in {
  display: block;
  width: 100%;
  padding: 20px;
}
.scenarios-block .add-container .content-container .content-files .content-files-list {
  display: block;
  width: 100%;
  background: #fff;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row {
  display: flex;
  flex-wrap: wrap;
  justify-content: center;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item {
  width: 80px;
  position: relative;
  padding: 10px;
  margin: 0;
  display: flex;
  align-items: center;
  justify-content: center;
  min-height: 80px;
  border: 1px solid #e4e4e4;
  border-left: none;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item a {
  flex: 0 0 auto;
  display: inline-block;
  max-width: 100%;
  height: auto;
  font-size: 40px;
  text-decoration: none;
  color: #333333;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item a i {
  display: block;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item span {
  font-size: 16px;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item:first-child {
  border-left: 1px solid #e4e4e4;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row .content-files-item:hover a {
  color: #3d9de1;
}
.scenarios-block .add-container .content-container .content-files .content-files-list .content-files-row.bt-none .content-files-item {
  border-top: none !important;
}

.options-open.scenarios-options .content-container {
  height: 160px !important;
}
.options-open.scenarios-options .content-container .content-files {
  height: 120px !important;
  margin-top: 20px;
  width: auto !important;
}

#audio-content {
  display: inline-block;
}
#audio-content .content-grid {
  display: inline-block;
}

.preview-item {
  position: relative;
  width: 100%;
  display: flex;
  padding: 0;
  flex-flow: row wrap;
  justify-content: space-between;
}
.preview-item .panel-featured-primary,
.preview-item .audio-player-container {
  width: 100%;
}
.preview-item .audio-player-settings {
  width: 100%;
}
.preview-item .audio-player-container .audioplayer {
  border: 1px solid #cecece;
  padding: 10px;
  border-radius: 4px;
  height: 82px;
}
.preview-item .audio-player-container .audioplayer .ap-controls-right {
  padding-right: 0 !important;
}

.con-playpause-con + .con-playpause-con {
  margin-left: -7px !important;
}

.con-playpause-con-md {
  margin-top: 10px;
}
.con-playpause-con-md .con-playpause.con-playpause-md {
  width: 30px !important;
  height: 30px !important;
}

.mg-table.player {
  display: inline-block !important;
}

.panel-featured-primary.player .progress {
  height: 15px !important;
  background-color: #f5f5f5 !important;
}

.input-group-answers {
  background-color: #D1D7DC;
  display: block;
  margin: 10px 0;
  position: relative;
}
.input-group-answers label {
  padding: 12px 50px 12px 12px;
  width: 100%;
  display: block;
  text-align: left;
  color: #3C454C;
  font-size: 12px;
  cursor: pointer;
  position: relative;
  z-index: 2;
  transition: color 200ms ease-in;
  overflow: hidden;
  margin: 0;
}
.input-group-answers label:before {
  width: 40px;
  height: 10px;
  border-radius: 50%;
  content: "";
  background-color: #175D7F;
  position: absolute;
  left: 50%;
  top: 50%;
  transform: translate(-50%, -50%) scale3d(1, 1, 1);
  transition: all 300ms cubic-bezier(0.4, 0, 0.2, 1);
  opacity: 0;
  z-index: -1;
}
.input-group-answers label:after {
  width: 32px;
  height: 32px;
  content: "";
  border: 1px solid #c1c4cd;
  background-color: #fff;
  background-image: url("data:image/svg+xml,%3Csvg width='32' height='32' viewBox='0 0 32 32' xmlns='http://www.w3.org/2000/svg'%3E%3Cpath d='M5.414 11L4 12.414l5.414 5.414L20.828 6.414 19.414 5l-10 10z' fill='%23fff' fill-rule='nonzero'/%3E%3C/svg%3E ");
  background-repeat: no-repeat;
  background-position: 2px 3px;
  border-radius: 50%;
  z-index: 2;
  position: absolute;
  right: 20px;
  top: 50%;
  transform: translateY(-50%);
  cursor: pointer;
  transition: all 200ms ease-in;
}
.input-group-answers input:checked ~ label {
  color: #fff;
}
.input-group-answers input:checked ~ label:before {
  transform: translate(-50%, -50%) scale3d(56, 56, 1);
  opacity: 1;
}
.input-group-answers input:checked ~ label:after {
  background-color: #15A2EE;
  border-color: #15A2EE;
}
.input-group-answers input {
  width: 32px;
  height: 32px;
  order: 1;
  z-index: 2;
  position: absolute;
  right: 30px;
  top: 50%;
  transform: translateY(-50%);
  cursor: pointer;
  visibility: hidden;
}

.body-coding-in-minecraft .input-group-answers {
  border-radius: 4px !important;
}
.body-coding-in-minecraft .input-group-answers label:before {
  width: 40px;
  height: 10px;
  border-radius: 50%;
  content: "";
  background-color: #15A2EE;
  position: absolute;
  left: 50%;
  top: 50%;
  transform: translate(-50%, -50%) scale3d(1, 1, 1);
  transition: all 300ms cubic-bezier(0.4, 0, 0.2, 1) !important;
  opacity: 0;
  z-index: -1;
}
.body-coding-in-minecraft .input-group-answers label:after {
  z-index: 2;
  right: 20px;
  top: 50%;
  cursor: pointer;
  content: "";
  width: 32px;
  height: 32px;
  border: 2px solid #15A2EE;
  border-radius: 50%;
  background: white;
  position: absolute;
  transform: translateY(-50%);
}
.body-coding-in-minecraft .input-group-answers input:checked ~ label {
  color: #fff !important;
  font-weight: bold !important;
}
.body-coding-in-minecraft .input-group-answers input:checked ~ label:before {
  border-radius: 4px;
  height: 100%;
  opacity: 1;
  width: 100%;
  transform: unset !important;
  top: 0;
  left: 0;
}
.body-coding-in-minecraft .input-group-answers input:checked ~ label:after {
  background-color: #15A2EE;
  border: 5px solid #ffffff;
}
.body-coding-in-minecraft .input-group-answers input {
  width: 32px;
  height: 32px;
  order: 1;
  z-index: 2;
  position: absolute;
  right: 30px;
  top: 50%;
  transform: translateY(-50%);
  cursor: pointer;
  visibility: hidden;
}

.modal-question-preview {
  padding: 0 !important;
}
.modal-question-preview .questions-take {
  padding: 0 15px !important;
}
.modal-question-preview .panel-question-v2 {
  background-color: #2b9bc7;
  color: #ffffff;
  border-radius: 0;
  padding: 15px 15px 1px !important;
}
.modal-question-preview .panel-question-v2 .text-question {
  padding: 10px 0;
  margin: 0;
  margin-top: -15px;
}
.modal-question-preview .stimulus-question {
  margin: 0 -18px -18px;
}

.stimulus-question {
  background: #fdfdfd;
  padding: 18px;
  border-top: 1px solid #DADADA;
  color: #777;
}

.panel.panel-questions {
  border: none !important;
}
@media only screen and (max-width: 767px) {
  .panel.panel-questions .panel-title {
    margin-right: 0;
  }
}
.panel.panel-questions .panel-body:not(.panel-body-scneario) {
  box-shadow: none !important;
}
.panel.panel-questions .panel-heading:not(.panel-question-v2) {
  background-color: #fdfdfd;
}
.panel.panel-questions .panel-heading.panel-question-v2 {
  border-radius: 0 !important;
  background-color: #2b9bc7 !important;
  color: #ffffff;
  padding: 15px 15px 1px !important;
}
.panel.panel-questions .panel-heading.panel-question-v2 .text-question {
  padding: 10px 0;
  margin: 0;
  margin-top: -15px;
}
.panel.panel-questions .panel-heading .stimulus-question {
  margin: 0 -15px -18px;
}
.panel.panel-questions .panel-heading .panel-title {
  font-size: 12px;
}
.panel.panel-questions #scenario-content-run figure {
  background-color: #efefef;
}
.panel.panel-questions .questions-take {
  margin: 0 auto;
  width: 80%;
  padding: 20px;
}
.panel .panel-body-scneario {
  border-bottom-left-radius: 0;
  border-bottom-right-radius: 0;
  border-bottom: 1px solid #DADADA;
}
.panel .panel-body-scneario + .panel-heading {
  border-top-left-radius: 0;
  border-top-right-radius: 0;
}

.test-runner-simple .panel-questions .panel-heading,
.test-runner-simple .panel-questions .panel-body {
  background: transparent !important;
}
.test-runner-simple .panel-questions .panel-body {
  box-shadow: none !important;
}

table.multiple-choice tbody tr:first-child td {
  border-top: none !important;
}

#content-Sims .shadow {
  box-shadow: 3px 3px 10px #666666;
}
#content-Sims .center {
  display: -webkit-box;
  display: -moz-box;
  display: box;
  -webkit-box-orient: vertical;
  -webkit-box-pack: center;
  -webkit-box-align: center;
  -moz-box-pack: center;
  -moz-box-align: center;
  box-orient: vertical;
  box-pack: center;
  box-align: center;
}
#content-Sims ::-webkit-scrollbar {
  width: 5px;
  height: 5px;
  background-color: #eee;
}
#content-Sims ::-webkit-scrollbar-thumb {
  background-color: rgba(0, 0, 0, 0.4);
  border-radius: 5px;
}
#content-Sims ::-webkit-scrollbar-thumb:hover {
  background-color: rgba(0, 0, 0, 0.8);
}
#content-Sims #container {
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  height: 100%;
}
#content-Sims #container > div {
  padding: 10px;
}
#content-Sims #container > div:first-of-type {
  overflow-y: auto;
  overflow-x: hidden;
  width: 500px;
  border-right: 1px solid #ccc;
}
#content-Sims #container > div:last-of-type {
  overflow-y: auto;
  overflow-x: hidden;
  -webkit-box-flex: 1;
}
#content-Sims #container .form-group {
  padding: 0;
}
#content-Sims #container .has-error .input-file-trigger,
#content-Sims #container .has-error #btn-upload-directory {
  border: 2px solid #a94442;
}
#content-Sims #container .input-file-container {
  position: relative;
  width: 225px;
}
#content-Sims #container .input-file-container .input-file-trigger {
  border-radius: 4px;
  display: block;
  padding: 10px 20px;
  background: #5CB85C;
  color: #fff;
  font-size: 14px;
  transition: all 0.4s;
  cursor: pointer;
}
#content-Sims #container .input-file-container .input-file {
  position: absolute;
  top: 0;
  left: 0;
  width: 225px;
  opacity: 0;
  padding: 14px 0;
  cursor: pointer;
}
#content-Sims #container .input-file-container .input-file:hover + .input-file-trigger:hover, #content-Sims #container .input-file-container .input-file:hover + .input-file-trigger:focus, #content-Sims #container .input-file-container .input-file:focus + .input-file-trigger:hover, #content-Sims #container .input-file-container .input-file:focus + .input-file-trigger:focus {
  background: #34495E;
  color: #5CB85C;
}
#content-Sims #container .file-return {
  margin: 0;
  font-style: italic;
  font-size: 0.9em;
  font-weight: bold;
}
#content-Sims #container .file-return:not(:empty) {
  margin: 1em 0;
}
#content-Sims #container .file-return:not(:empty)::before {
  content: "Selected: ";
  font-style: normal;
  font-weight: normal;
}

.image-drag-matching .panel-featured,
.drag-matching .panel-featured {
  border-style: solid;
  border-width: 1px;
  min-height: 55px;
  background: #fff;
  border-radius: 5px;
  font-size: 12px;
}
.image-drag-matching .panel-featured .panel-body,
.drag-matching .panel-featured .panel-body {
  cursor: all-scroll;
}
.image-drag-matching .portlet-placeholder,
.drag-matching .portlet-placeholder {
  border: 1px dashed #dddddd;
  background: #CFCFCF;
}
.image-drag-matching .left-content .panel-body,
.drag-matching .left-content .panel-body {
  background: rgb(246, 246, 246);
  border-radius: 5px;
}
.image-drag-matching .portlet-placeholder .panel-heading,
.drag-matching .portlet-placeholder .panel-heading {
  background: transparent !important;
}
.image-drag-matching .right-content div.panel-heading,
.drag-matching .right-content div.panel-heading {
  border-radius: 5px 5px 0 0;
  padding: 15px;
}
.image-drag-matching .right-content div.panel-heading:only-child,
.drag-matching .right-content div.panel-heading:only-child {
  border-radius: 5px;
  border-bottom: none;
}

.drag-to-paragraph .panel-featured {
  border-style: solid;
  border-width: 1px;
  min-height: 25px;
  min-width: 60px;
  background: #fff;
  border-radius: 5px;
  display: inline-block;
  font-size: 12px;
}
.drag-to-paragraph .panel-featured .panel-body {
  cursor: all-scroll;
}
.drag-to-paragraph .portlet-placeholder {
  border: 1px dashed #dddddd;
  background: #CFCFCF;
  margin-bottom: 0;
}
.drag-to-paragraph .left-content .panel-body {
  background: rgb(246, 246, 246);
  border-radius: 5px;
}
.drag-to-paragraph .right-content .panel-featured {
  width: 100px;
}
.drag-to-paragraph hr {
  box-sizing: border-box;
  border: none;
  background: #cecece;
}
.drag-to-paragraph .drag-container {
  width: 150px;
  display: inline;
}
.drag-to-paragraph .left-content .dragzones {
  cursor: move;
}
.drag-to-paragraph .dragzones {
  padding: 0 5px;
}
.drag-to-paragraph .occupied {
  width: auto !important;
  cursor: default;
  border-left: none !important;
  border-right: none !important;
  border-top: none !important;
  border-radius: 0 !important;
}
.drag-to-paragraph .ui-draggable-dragging {
  box-shadow: 0 0 2px #000;
  overflow: hidden;
  text-overflow: ellipsis;
  white-space: normal;
  -webkit-line-clamp: 1;
  -webkit-box-orient: vertical;
  display: -webkit-box !important;
  width: 120px;
  cursor: move;
}

.drag ul[dnd-list] {
  min-height: 42px;
  padding-left: 0px;
}
.drag ul[dnd-list] li {
  background-color: #fff;
  border: 1px solid #ddd;
  display: block;
  margin: 5px;
  min-height: 45.5px !important;
}
.drag ul[dnd-list] li.li-image {
  min-height: 120px !important;
  max-height: 120px !important;
  position: relative;
}
.drag ul[dnd-list] li.li-image .btn-draggable {
  position: absolute;
  width: 100%;
  height: 100%;
}
.drag ul[dnd-list] li.li-image img {
  height: 100% !important;
  margin: 0 auto;
}
.drag ul[dnd-list] li.placeholder-answer {
  background-color: #ddd;
  border: dashed 1px #777;
}
.drag ul[dnd-list] li.placeholder-option {
  background-color: #eee;
  border: dashed 1px #777;
}
.drag ul[dnd-list] li .btn-draggable {
  min-height: 22px !important;
  padding: 10px 15px;
  cursor: move;
}
.drag ul[dnd-list] li .drag-ansers {
  padding: 10px 15px;
}

.sort ol[dnd-list] {
  list-style: none;
  counter-reset: custom-counter;
  min-height: 42px;
  padding-left: 0px;
}
.sort ol[dnd-list] li {
  counter-increment: custom-counter;
  background-color: #fff;
  border: 1px solid #ddd;
  display: block;
  margin: 5px;
  min-height: 45.5px !important;
}
.sort ol[dnd-list] li.list-answers::before {
  content: counter(custom-counter) ". ";
  position: absolute;
  left: -1.5px;
  font-weight: bold;
}
.sort ol[dnd-list] li.placeholder-answer {
  background-color: #ddd;
  border: dashed 1px #777;
}
.sort ol[dnd-list] li.placeholder-option {
  background-color: #eee;
  border: dashed 1px #777;
}
.sort ol[dnd-list] li .btn-draggable {
  min-height: 22px !important;
  padding: 10px 15px;
  cursor: move;
}

.imagemultiple-choice {
  width: 100% !important;
  display: flex;
  flex-direction: row;
  flex-wrap: wrap;
  justify-content: space-evenly;
}
.imagemultiple-choice .view-options-img {
  width: 130px;
}
.imagemultiple-choice .view-options-img .input-group-answers {
  width: 130px;
  height: 130px;
  position: relative;
  padding: 5px;
  border-radius: 4px;
  margin: 15px 0 4px 0;
}
.imagemultiple-choice .view-options-img .input-group-answers:not(.ismarked):hover {
  background: #cecece;
  /*.container-image-choice {
      width: 105%;
      height: 105%;
  }*/
}
.imagemultiple-choice .view-options-img .input-group-answers.ismarked {
  background: #175d7f;
}
.imagemultiple-choice .view-options-img .input-group-answers .container-image-choice {
  background: #FFFFFF;
  width: 100%;
  height: 100%;
  /* background: #FFFFFF;
  width: 100%;
  height: 100%;

  img {
      max-height: 80%;
      max-width: 80%;
      width: auto;
      height: auto;
      position: absolute;
      top: 5%;
      bottom: 5%;
      left: 5%;
      right: 5%;
      margin: auto;
  }*/
}
.imagemultiple-choice .view-options-img .input-group-answers .container-image-choice img {
  max-height: 80%;
  max-width: 80%;
  width: auto;
  height: auto;
  position: absolute;
  top: 5%;
  bottom: 5%;
  left: 5%;
  right: 5%;
  margin: auto;
}
.imagemultiple-choice .view-options-img .label-default {
  color: #FFFFFF;
  background: #595959;
  display: inline-table;
  white-space: unset;
}

.triangle {
  width: 136px;
  height: 136px;
  display: inline-block;
}
.triangle:after, .triangle.border:before {
  position: absolute;
  content: "";
  width: 0;
  height: 0;
}
.triangle.border:before {
  z-index: -1;
  margin-top: -9px;
  margin-left: -6px;
}
.triangle.marked:after {
  border-right: 65px solid transparent;
}
.triangle.marked:after {
  border-top: 65px solid #175d7f;
}
.triangle i {
  color: #FFFFFF;
  font-size: 25px;
  font-weight: 600;
  position: absolute;
  top: 12px;
  z-index: 9;
  left: 12px;
}

.scenario-viwer {
  width: 100%;
  padding: 15px;
}
.scenario-viwer .panel {
  width: 100%;
  margin: 0 auto;
}

.panel-mcwri {
  display: flex;
  flex-direction: row;
}
.panel-mcwri .container-options-mcwri {
  width: 70%;
  display: flex;
  flex-direction: column;
  justify-content: center;
  padding-bottom: 7%;
}
.panel-mcwri .content-sar2 {
  width: 30%;
  display: flex;
  justify-content: center;
  flex-direction: column;
}
.panel-mcwri .content-sar2 .view-options-img {
  width: 250px;
  margin-bottom: 60px;
}
.panel-mcwri .content-sar2 .view-options-img .input-group-answers {
  width: 250px;
  height: 250px;
  position: relative;
  padding: 15px;
  border-radius: 4px;
  margin: 15px 0 4px 0;
}
.panel-mcwri .content-sar2 .view-options-img .input-group-answers:not(.ismarked):hover {
  background: #FFFFFF;
}
.panel-mcwri .content-sar2 .view-options-img .input-group-answers.ismarked {
  background: #175d7f;
}
.panel-mcwri .content-sar2 .view-options-img .input-group-answers .container-image-choice {
  background: #FFFFFF;
  width: 100%;
  height: 100%;
}
.panel-mcwri .content-sar2 .view-options-img .input-group-answers .container-image-choice img {
  max-height: 80%;
  max-width: 80%;
  width: auto;
  height: auto;
  position: absolute;
  top: 5%;
  bottom: 5%;
  left: 5%;
  right: 5%;
  margin: auto;
}
.panel-mcwri .content-sar2 .view-options-img .label-default {
  color: #FFFFFF;
  background: #595959;
  display: inline-table;
  white-space: unset;
}

.panel-page-scenario .abp-dropzone-scenario {
  width: 100% !important;
}

.usedTemplate {
  height: 100px;
  position: relative;
  align-content: center;
  display: flex;
  align-items: center;
  flex-direction: column;
}
.usedTemplate img {
  max-height: 95%;
  max-width: 95%;
  width: auto;
  height: auto;
  position: absolute;
  top: 5%;
  bottom: 5%;
  border: 5px solid #cecece;
  border-radius: 15px;
  margin: auto;
}
.usedTemplate img.active-template {
  border: 5px solid #175D7F;
}

.options-page-scenario {
  position: absolute;
  right: 25px;
  z-index: 500;
}

.preview-upload-image {
  display: flex;
  justify-content: center;
}
.preview-upload-image .preview-item:not(.template2) {
  display: flex;
  flex-direction: column-reverse;
  background: transparent;
  width: 170px;
  height: 170px;
}
.preview-upload-image .preview-item:not(.template2) img {
  max-height: 170px;
  max-width: 170px;
  width: auto;
  height: auto;
  position: absolute;
  top: 5%;
  bottom: 5%;
  left: 0;
  right: 0;
  margin: auto;
}
.preview-upload-image .preview-item.template2 {
  background: transparent;
  width: 823px;
  height: 500px;
}
.preview-upload-image .preview-item.template2 img {
  max-height: 100%;
  max-width: 100%;
  width: auto;
  height: auto;
  position: absolute;
  top: 5%;
  bottom: 5%;
  left: 0;
  right: 0;
  margin: auto;
}

.vcenter {
  display: inline-block;
  vertical-align: middle;
  float: none;
}
.vcenter.create-text {
  margin-top: 10%;
}
.vcenter textarea {
  resize: none;
}

.container-ICWRC, .container-ICWI {
  display: flex;
  flex-direction: row;
  flex-wrap: nowrap;
}
.container-ICWRC .question-compression, .container-ICWI .question-compression {
  width: 60%;
  /* .tab-content {
      height: 450px;
  }*/
}
.container-ICWRC .question-options, .container-ICWI .question-options {
  width: 40%;
}

.container-image-with-text {
  display: flex;
  flex-direction: row;
  flex-wrap: nowrap;
}
.container-image-with-text .compression-text-image {
  width: calc(100% - 185px);
  display: flex;
  align-items: center;
}
.container-image-with-text .compression-image {
  display: flex;
  align-items: center;
  justify-content: center;
}
.container-image-with-text .compression-image .container-zomm-img {
  z-index: 50;
  justify-content: space-between;
  display: flex;
}

.view-zoom {
  display: flex;
  justify-content: flex-end;
}

.zoom-image {
  position: absolute;
  z-index: 55;
  background: #FFFFFF;
  width: 500px;
  height: 500px;
}
.zoom-image a {
  z-index: 50;
  position: absolute;
  right: 0;
}
.zoom-image img {
  max-height: 100%;
  max-width: 100%;
  width: auto;
  height: auto;
  position: absolute;
  top: 5%;
  bottom: 5%;
  left: 0;
  right: 0;
  margin: auto;
}

@media (max-width: 870px) {
  .container-ICWRC, .container-ICWI {
    display: flex;
    flex-direction: row;
    flex-wrap: wrap;
  }
  .container-ICWRC .question-compression, .container-ICWI .question-compression {
    width: 100%;
    /* .tab-content {
        height: 450px;
    }*/
  }
  .container-ICWRC .question-options, .container-ICWI .question-options {
    width: 100%;
  }
}
@media (max-width: 520px) {
  .container-image-with-text {
    display: flex;
    flex-direction: row;
    flex-wrap: wrap;
  }
  .container-image-with-text .compression-text-image {
    width: 100%;
    display: flex;
    align-items: center;
  }
}
.abp-dropzone-scenario .caption {
  z-index: 10;
}
.abp-dropzone-scenario .img-responsive {
  max-height: 75%;
  max-width: 95%;
  width: auto;
  height: auto;
  position: absolute;
  margin: auto;
  left: 50%;
  transform: translate(-50%, 0);
}

.scrollable-objectives {
  max-height: 45vh; /* Puedes ajustar este valor según el diseño */
  overflow-y: auto;
  padding-right: 1rem; /* espacio para que no tape el scrollbar */
}

.select-students table tbody tr .btn-round {
  border-radius: 28px;
  font-size: 12px;
  padding: 2px 13px;
  color: #fff !important;
  cursor: pointer;
}

.table-wrapper-scroll-y {
  display: block;
  max-height: 200px;
  overflow-y: auto;
  -ms-overflow-style: -ms-autohiding-scrollbar;
}

/*Custom style for assignment Content*/
.panel-class-assignment .panel-group .alert-danger {
  border-radius: 0;
  margin-top: -1px;
}
.panel-class-assignment .panel-accordion {
  border: none !important;
  margin-bottom: 20px;
}
.panel-class-assignment .panel-accordion .panel-heading {
  background-color: #5EADD8;
  color: #FFF;
  border-top: 1px solid #49a3d3;
  border-radius: 0 !important;
}
.panel-class-assignment .panel-accordion .accordion-body {
  padding: 0 15px 15px 15px;
  background-color: #5EADD8;
  border-bottom: 1px solid #49a3d3;
}
.panel-class-assignment .panel-accordion .accordion-body .panel-body {
  border-radius: 5px !important;
}

/*Variables mover a un archivo separad*/
/*Questions*/
.question-title {
  margin: 0 0 3px 0;
  padding: 0 0 3px 0;
  border: none;
  position: relative;
  width: 100%;
  line-height: 34px;
  word-wrap: break-word;
  white-space: normal;
  display: block;
}

/*Preview*/
.page-preview .checkbox-table:not(.use-radios) {
  margin: 0 auto;
  display: inline-block;
  padding-left: 10px;
}
.page-preview .header-banner {
  height: 200px;
  background: #0C5C82;
}
.page-preview .preview-container {
  margin: auto;
  width: 768px;
}
.page-preview .preview-container .principal-form {
  margin-top: -100px;
  background-color: #fff;
  margin-bottom: 48px;
  box-shadow: 0 1px 4px 0 rgba(0, 0, 0, 0.37);
  padding-bottom: 6px;
  word-wrap: break-word;
}
.page-preview .preview-container .principal-form .form-border {
  background-color: #0b5274;
  color: rgb(0, 0, 0);
  height: 8px;
}
.page-preview .preview-container .principal-form .form-survey {
  color: rgba(0, 0, 0, 0.87);
  padding: 34px 0;
}
.page-preview .preview-container .principal-form .form-survey .survey-headernoPadding {
  padding: 0;
}
.page-preview .preview-container .principal-form .form-survey .survey-headernoPadding .survey-header {
  margin-bottom: 22px;
}
.page-preview .preview-container .principal-form .form-survey .survey-headernoPadding .survey-header .survey-title {
  padding-left: 34px;
  padding-right: 34px;
  box-align: center;
  align-items: center;
  justify-content: space-between;
}
.page-preview .preview-container .principal-form .form-survey .survey-headernoPadding .survey-header .survey-title h2 {
  box-sizing: border-box;
  font-size: 34px;
  line-height: 135%;
  max-width: 100%;
  min-width: 0%;
}
.page-preview .preview-container .principal-form .form-survey .survey-bodyPadding {
  padding: 0 17px;
}
.page-preview .preview-container .principal-form .form-survey .survey-bodyPadding .form-section {
  margin-left: -17px;
  margin-right: -17px;
  align-items: stretch;
}
.page-preview .preview-container .principal-form .form-survey .survey-bodyPadding .form-section .section-header {
  background-color: #094866;
  color: rgb(255, 255, 255);
}
.page-preview .preview-container .principal-form .form-survey .survey-bodyPadding .form-section .section-header .section-title {
  font-size: 20px;
  font-weight: 500;
  font: 500 20px Roboto, RobotoDraft, Helvetica, Arial, sans-serif;
  padding: 16px 8px 16px 42px;
  padding-left: 34px;
}
.page-preview .preview-container .principal-form .form-survey .survey-bodyPadding .questions-row {
  background-color: transparent;
  margin-top: 2px;
  padding: 16px 17px;
  page-break-inside: avoid;
  transition: background-color 200ms cubic-bezier(0, 0, 0.2, 1);
}
.page-preview .preview-container .principal-form .form-survey .surve-footerPadding {
  padding: 0 34px;
}
.page-preview .preview-container .principal-form .form-survey .surve-footerPadding .survey-footer {
  margin-top: 34px;
  justify-content: space-between;
}
.page-preview .preview-container .principal-form .form-survey .surve-footerPadding .survey-footer .footer-buttons {
  padding-bottom: 10px;
  text-align: center;
}
.page-preview .preview-container .principal-form .form-survey .surve-footerPadding .survey-footer .footer-buttons button {
  line-height: 20px;
  min-width: 88px;
}

.survey-page select option:empty {
  display: none;
}
.survey-page .checkbox-table:not(.use-radios) {
  margin: 0 auto;
  display: inline-block;
  padding-left: 10px;
}
.survey-page .question-overflow {
  /*overflow-y: auto !important;*/
}
.survey-page .new-question-container {
  margin: 0;
  border: 1px solid #cecece;
  margin-top: -1px;
}
.survey-page .new-question-container .panel-heading {
  border-top-left-radius: 0 !important;
  border-top-right-radius: 0 !important;
}
.survey-page .new-question-container .panel-footer {
  border-bottom-left-radius: 0 !important;
  border-bottom-right-radius: 0 !important;
}
.survey-page .question {
  border-bottom: 1px solid transparent;
  min-height: 54px;
  padding: 5px;
}
.survey-page .question {
  position: relative;
  transition: background-color 350ms ease-out;
  max-width: 100%;
  box-sizing: border-box;
  padding-bottom: 20px;
  border-bottom: 1px dashed #D0D2D3;
}
.survey-page .question .question-actions {
  position: absolute;
  top: 0;
  right: 0;
  padding: 10px 20px 0 0;
  z-index: 90;
  text-align: right;
  font-size: 13px;
  white-space: nowrap;
  zoom: 1;
  display: none;
  height: 100%;
  width: 100%;
  cursor: auto;
}
.survey-page .question .question-actions a {
  cursor: pointer;
  padding: 0 5px;
  text-decoration: none;
}
.survey-page .question .question-actions a:last-child {
  padding-right: 0;
}
.survey-page .question .move-question {
  position: absolute;
  z-index: 92;
  top: 0;
  left: 0;
  text-align: left;
  font-size: 13px;
  padding: 12px 20px 0 0;
  zoom: 1;
  display: none;
}
.survey-page .question .move-question a {
  min-width: 100px;
  color: #02ABDC;
}
.survey-page .question .survey-actions {
  position: absolute;
  z-index: 91;
  zoom: 1;
  bottom: -15px;
  left: 50%;
  transform: translateX(-50%);
  display: none;
}
.survey-page .questions .questions-row {
  margin: 1px 0 30px 0 !important;
}
.survey-page .questions .questions-row .question-container {
  padding: 0;
}
.survey-page .questions .questions-row .question-container .question-title {
  color: #02ABDC;
  font-size: 20px;
  font-weight: 400;
  font-style: normal;
  text-decoration: none;
}
.survey-page .questions .questions-row .question-container .question.hvr:hover {
  cursor: pointer;
}
.survey-page .questions .questions-row .question-container .question.hvr:hover .question-actions,
.survey-page .questions .questions-row .question-container .question.hvr:hover .survey-actions,
.survey-page .questions .questions-row .question-container .question.hvr:hover .move-question {
  display: block;
}
.survey-page .questions .questions-row.intable {
  border-bottom: 1px solid #cecece;
}
.survey-page .questions .questions-row .question-title-hide {
  color: #777;
  line-height: 22px;
  font-weight: bold;
  font-size: 13px;
  display: none;
  padding: 15px;
}
.survey-page .questions .questions-row:last-child .question {
  border-bottom: none;
}
.survey-page .questions .questions-row .question-bank {
  margin-top: -1px;
}
@media screen and (max-width: 992px) {
  .survey-page .questions .questions-row .question-title-hide {
    display: block;
  }
  .survey-page .questions .questions-row .question-answered {
    padding-bottom: 15px !important;
  }
}
.survey-page .question-body {
  color: #333E48;
  font-size: 16px;
  font-weight: 300;
  font-style: normal;
  text-decoration: none;
  overflow: hidden;
}
.survey-page .question-body .widget-todo-list {
  list-style-type: disc;
  padding-left: 27px;
}
.survey-page .question-body .widget-todo-list li {
  padding: 5px;
  font-size: 15px;
  border-bottom: none !important;
}
.survey-page .question-body .answer-col {
  float: left;
  width: 50%;
}
.survey-page .question-body label {
  font-size: 14px;
  display: block;
  word-wrap: break-word;
  white-space: normal;
  line-height: 24px;
}
.survey-page .panel.with-sections {
  border-radius: 0 !important;
  border: none;
}
.survey-page .panel.with-sections > .panel-body {
  border: 1px solid #cecece;
  border-top: none;
}
.survey-page .panel.with-sections .panel.edit-section {
  border: none;
  border-radius: 0;
  border-bottom: 1px solid #cecece;
}
.survey-page .panel.with-sections .panel.edit-section .panel-footer {
  border-bottom: 1px solid #cecece;
}
.survey-page .panel.with-sections .section-content {
  position: relative;
  padding: 10px 20px;
  background-color: #02ABDC;
  border-top-left-radius: 4px;
  border-top-right-radius: 4px;
  border-color: #0297c3;
  border-width: 1px;
  border-style: solid;
  border-bottom: none;
}
.survey-page .panel.with-sections .section-content .section-title {
  font-size: 22px;
  text-decoration: none;
  font-weight: 400;
  margin: 0;
  color: #ffffff;
}
.survey-page .panel.with-sections .section-content .section-actions {
  position: absolute;
  top: 0;
  left: 0;
  padding: 10px 20px 10px 0;
  z-index: 90;
  width: 100%;
  height: 100%;
  text-align: right;
  font-size: 13px;
  white-space: nowrap;
  zoom: 1;
  display: none;
}
.survey-page .panel.with-sections .section-content .section-actions a {
  cursor: pointer;
  padding: 0 5px;
  text-decoration: none;
}
.survey-page .panel.with-sections .section-content .section-actions a:last-child {
  padding-right: 0;
}
.survey-page .panel.with-sections .section-content.hvr:hover .section-actions {
  display: block;
}
.survey-page .panel.with-sections .questions-row {
  padding: 15px;
  margin-bottom: 0px !important;
  padding-bottom: 10px !important;
}
.survey-page .panel.with-sections .questions-row:last-of-type {
  padding-bottom: 15px !important;
}
.survey-page .table-questions {
  border-color: #e2e7eb;
  border-radius: 3px;
}
.survey-page .table-questions > tbody > tr > td {
  border-color: #e2e7eb;
  padding: 10px 15px;
}
.survey-page .table-questions > tbody > tr > td:first-child {
  border-left: 5px solid #FFF;
}
.survey-page .table-questions > tbody > tr > td:first-child.color1 {
  border-left-color: #3949AB;
}
.survey-page .table-questions > tbody > tr > td:first-child.color2 {
  border-left-color: #039BE5;
}
.survey-page .table-questions > tbody > tr > td:first-child.color3 {
  border-left-color: #00897B;
}
.survey-page .table-questions > tbody > tr > td:first-child.color4 {
  border-left-color: #7CB342;
}
.survey-page .table-questions > tbody > tr > td:first-child.color5 {
  border-left-color: #FDD835;
}
.survey-page .table-questions > tbody > tr > td:first-child.color6 {
  border-left-color: #FB8C00;
}
.survey-page .table-questions > tbody > tr > td:first-child.color7 {
  border-left-color: #6D4C41;
}
.survey-page .table-questions > tbody > tr > td:first-child.color8 {
  border-left-color: #F4511E;
}
.survey-page .table-questions > tbody > tr > td:first-child.color9 {
  border-left-color: #8E24AA;
}
.survey-page .table-questions > tbody > tr > td:first-child.color10 {
  border-left-color: #D81B60;
}
.survey-page .table-questions > tbody > tr > td:first-child.color11 {
  border-left-color: #e53935;
}
.survey-page .table-questions > tbody > tr > td:first-child.color12 {
  border-left-color: #546E7A;
}
.survey-page .table-questions > thead > tr > th {
  border-bottom: none !important;
  padding-left: 0;
  padding-right: 0;
}
@media screen and (max-width: 992px) {
  .survey-page .table-questions > thead {
    display: none;
  }
  .survey-page .table-questions > tbody > tr:first-child > td {
    border-top: none;
  }
}
.survey-page .chart-pie {
  height: 200px !important;
  margin-top: 15px;
  margin-bottom: 5px;
}
@media screen and (max-width: 992px) {
  .survey-page .panel-preview {
    width: 100%;
  }
}

/* Content With Menu - Menu and Body */
@media only screen and (min-width: 768px) {
  .panel-media-gallery {
    /* Toolbar */
  }
  .panel-media-gallery .content-with-menu {
    margin: -40px -40px -53px -40px;
    min-height: 100vh;
    border-top: 0px solid transparent;
  }
  .panel-media-gallery .inner-body {
    margin-left: 0 !important;
  }
  .panel-media-gallery .inner-toolbar {
    transition: all 0.3s ease-in;
    background: #fff;
    border-bottom: 1px solid #cecece !important;
    border-left: 0 !important;
    position: static !important;
  }
  .panel-media-gallery .inner-toolbar > ul {
    padding: 0 15px;
  }
  .panel-media-gallery .inner-toolbar > ul > li {
    border-right: none;
  }
  .panel-media-gallery .inner-toolbar > ul > li > a {
    color: #999;
  }
  .panel-media-gallery .inner-toolbar > ul > li > a:hover, .panel-media-gallery .inner-toolbar > ul > li > a:focus {
    color: #777;
  }
  .panel-media-gallery .inner-toolbar > ul > li > a.active {
    color: #535353;
  }
  .panel-media-gallery .media-gallery .mg-files {
    padding: 5px 30px 20px 30px;
    margin-bottom: 10px;
  }
  .panel-media-gallery .media-gallery .mg-files .thumbnail .mg-title {
    font-size: 1.5rem;
  }
}
/* Content With Menu - Responsive */
@media only screen and (max-width: 767px) {
  .panel-media-gallery .content-with-menu {
    margin: 0;
  }
  .panel-media-gallery .mg-files {
    padding: 0 15px;
  }
  .panel-media-gallery .inner-toolbar {
    background: transparent;
    border-left: none;
  }
  .panel-media-gallery .inner-toolbar > ul > li > a {
    color: #999;
  }
  .panel-media-gallery .inner-toolbar > ul > li > a:hover, .panel-media-gallery .inner-toolbar > ul > li > a:focus {
    color: #777;
  }
  .panel-media-gallery .inner-toolbar > ul > li > a.active {
    color: #535353;
  }
  .panel-media-gallery .inner-body {
    border-bottom: 15px;
  }
}
/* Toolbar + Layout Fixed */
@media only screen and (min-width: 768px) {
  html.scroll .panel-media-gallery,
  html.boxed .panel-media-gallery,
  html.fixed .panel-media-gallery {
    /*.inner-toolbar {
        top: $header-height + $page-header-height + 32;                
        right: 25px;
    }*/
  }
  html.scroll .panel-media-gallery .content-with-menu-has-toolbar .inner-body,
  html.boxed .panel-media-gallery .content-with-menu-has-toolbar .inner-body,
  html.fixed .panel-media-gallery .content-with-menu-has-toolbar .inner-body {
    border-top-width: 110px;
    padding-top: 0;
  }
  html.scroll .panel-media-gallery .content-with-menu::before,
  html.boxed .panel-media-gallery .content-with-menu::before,
  html.fixed .panel-media-gallery .content-with-menu::before {
    background: transparent;
  }
  html.scroll .panel-media-gallery .content-with-menu::after,
  html.boxed .panel-media-gallery .content-with-menu::after,
  html.fixed .panel-media-gallery .content-with-menu::after {
    background: transparent;
    box-shadow: none;
  }
}
/* Resolution gt 767 and lt 1366 - Hide Inner Menu */
@media only screen and (min-width: 768px) and (max-width: 1365px) {
  html.fixed .panel-media-gallery .content-with-menu-has-toolbar .inner-toolbar,
  html.scroll .panel-media-gallery .content-with-menu-has-toolbar .inner-toolbar,
  html.boxed .panel-media-gallery .content-with-menu-has-toolbar .inner-toolbar {
    padding-left: 0;
  }
}
/* Resolution gt 1366 - Show Inner Menu */
@media only screen and (min-width: 1366px) {
  html.fixed .panel-media-gallery .content-with-menu-has-toolbar .inner-toolbar,
  html.scroll .panel-media-gallery .content-with-menu-has-toolbar .inner-toolbar,
  html.boxed .panel-media-gallery .content-with-menu-has-toolbar .inner-toolbar {
    padding-left: 0;
  }
  html.fixed .panel-media-gallery .content-with-menu .inner-toolbar,
  html.fixed.inner-menu-opened .panel-media-gallery .content-with-menu .inner-toolbar {
    left: 300px;
  }
  html.fixed.sidebar-right-opened .panel-media-gallery .content-with-menu .inner-toolbar {
    left: 300px;
  }
  html.fixed.sidebar-left-collapsed .panel-media-gallery .content-with-menu .inner-toolbar,
  html.fixed.sidebar-left-collapsed.sidebar-right-opened.inner-menu-opened .panel-media-gallery .content-with-menu .inner-toolbar,
  html.fixed.sidebar-left-collapsed.inner-menu-opened .panel-media-gallery .content-with-menu .inner-toolbar {
    left: 123px;
  }
  html.fixed.sidebar-left-collapsed.sidebar-right-opened .panel-media-gallery .content-with-menu .inner-toolbar {
    left: 73px;
  }
}
.video-media-element {
  display: block;
  height: 334px;
  max-width: 334px;
  width: 100%;
  background: #000;
}

.btn-storage {
  margin-top: -16px !important;
}

/*.main-section-course
{
    font-size:13px;
}*/
.course-legend li i {
  width: 20px;
}

.course-infodetails li {
  padding: 0;
}
.course-infodetails li .title {
  font-size: 1.5rem;
}
.course-infodetails li .message {
  font-size: 1.3rem;
}

.profile-info-ms {
  display: contents;
}
.profile-info-ms .profile-picture {
  margin-top: 10px;
  margin-left: 15px;
}
.profile-info-ms .profile-account {
  margin-top: 10px;
}
.profile-info-ms .profile-stats {
  padding-top: 9px;
  margin-right: 14px !important;
}

.report-items {
  max-height: 400px;
  height: 239px;
  padding: 1px;
  width: 100%;
  overflow-x: scroll;
  overflow-y: hidden;
  white-space: nowrap;
  -webkit-user-select: none;
          user-select: none;
  /*cursor: pointer;*/
  transition: all 0.2s;
  position: relative;
  background: #ffffff;
  font-size: 0;
  perspective: 400px;
  display: flex;
}
.report-items tooltip tip {
  padding: 2px 5px 5px 5px !important;
  min-width: unset;
  /*top: -4px !important;*/
}

.bg-primary-Primary-course {
  background: #FFF !important;
  color: #00aadc;
}

.bg-primary {
  border: 1px solid #00aadc;
}

.report-item {
  width: 150px;
  height: calc(100% - 0px);
  display: inline-block;
  font-size: 14px;
  font-weight: 100;
  margin-right: 1px;
  border-radius: unset;
  display: inline-flex;
}
.report-item .tip-tip {
  font-size: 13px;
}
.report-item .widget-twitter-profile {
  background-color: transparent;
  width: 100%;
  /*.profile-account {
      margin-top: 7px;
  }*/
}
.report-item .widget-twitter-profile .profile-icon {
  list-style: none;
  padding-right: 3px;
  padding-top: 10px;
  margin: 0;
}
.report-item .widget-twitter-profile .padding-subsection {
  padding: 3px;
  margin: 0;
}
.report-item .widget-twitter-profile .profile-info {
  display: flex;
  background-color: rgba(0, 0, 0, 0.18);
  /*padding: 10px 5px 5px 5px;*/
  min-height: 60px;
  /*.profile-stats {
      margin-left: auto;
  }*/
}
.report-item .widget-twitter-profile .profile-info table {
  width: -webkit-fill-available;
  max-height: 60px;
}
.report-item .widget-twitter-profile .profile-info table tr.ttl-subsection {
  width: 100%;
  height: 20px;
}
.report-item .widget-twitter-profile .profile-info table tr.ttl-subsection td:first-child {
  width: 10px;
  padding-left: 5px;
}
.report-item .widget-twitter-profile .profile-info table tr.ttl-subsection td:first-child span {
  margin-right: 5px;
}
.report-item .widget-twitter-profile .profile-info table tr.ttl-subsection td:last-child {
  width: calc(98% - 20px);
}
.report-item .widget-twitter-profile .profile-info table tr.ttl-subsection td h4 {
  font-size: 1.4rem;
  font-weight: inherit;
}
.report-item .widget-twitter-profile .profile-info .profile-stats li {
  padding-left: 0;
  padding-right: 5px;
}
.report-item .widget-twitter-profile .profile-info .profile-stats li h4 {
  font-size: 1.4rem;
  font-weight: inherit;
}
.report-item .widget-twitter-profile .profile-info .profile-stats li h5 {
  font-size: 0.8rem;
  font-weight: inherit;
}
.report-item .widget-twitter-profile .profile-info .profile-stats {
  float: none;
}
.report-item .widget-twitter-profile .profile-info .profile-stats li:first-child {
  padding-left: 5px !important;
}
.report-item .widget-twitter-profile .simple-icon {
  align-items: center;
  justify-content: center;
}
.report-item .widget-twitter-profile .profile-quote {
  background-color: transparent;
  max-height: 160px;
  padding: unset;
}
.report-item .widget-twitter-profile .profile-account-lg {
  width: calc(100% - 20px);
}
.report-item .widget-twitter-profile .profile-account-sm {
  width: 100%;
}
.report-item .tltcontent {
  height: 80px;
  width: 100%;
  border-top: 1px solid #ffffff;
  border-bottom: 1px solid #ffffff;
  align-items: center;
  justify-content: center;
  display: inline-flex;
  overflow: hidden;
}
.report-item .text-left {
  display: -webkit-box !important;
}
.report-item .statis-content {
  min-height: 80px;
  width: 100%;
  background-color: transparent;
  /*background-color: rgba(0,0,0,0.18);*/
}
.report-item .report-subitem {
  width: 150px;
  min-height: 340px;
  font-size: 14px;
  font-weight: 100;
  margin-right: 1px;
  border-radius: unset;
  border-right: 1px solid #ffffff;
}
.report-item .report-subitem .tltcontent {
  height: 40px;
  width: 100%;
  border-top: 1px solid #ffffff;
  border-bottom: 1px solid #ffffff;
  align-items: center;
  justify-content: center;
  display: flex;
}
.report-item .report-subitem .tltcontent:first-child {
  /*background-color: #00ff21;*/
  border-bottom: 0px;
  overflow: visible !important;
}
.report-item .report-subitem .tltcontent div:first-child {
  margin-right: 5px;
}
.report-item .report-subitem:last-child {
  margin-right: 0px;
  border-right: 0px;
}
.report-item .text-overflow {
  width: 90%;
  white-space: nowrap;
  overflow: hidden;
  text-overflow: ellipsis;
}
.report-item .text-overflow-notcut:hover {
  transition: margin 2s linear;
  margin: 0 0 0 -200px;
}
.report-item .text-overflow-notcut {
  /*width: inherit;*/
  white-space: nowrap;
  padding: 0 7px 0 7px;
  box-sizing: border-box;
  transition: margin 1s linear;
}
.report-item .blocquote-felx {
  display: inline-flex;
}
.report-item .item-statis {
  display: flex;
  width: 100%;
}
.report-item .item-statis .icon-statis {
  height: 40px;
  width: 75px;
  display: inline-table;
  border-right: 1px solid #ffffff;
  border-bottom: 1px solid #ffffff;
  align-items: center;
  justify-content: center;
  display: flex;
}
.report-item .item-statis .icon-statis div {
  align-items: center;
  justify-content: center;
  display: flex;
}
.report-item .item-statis .icon-statis div.info-icon {
  font-size: 1.3em;
}
.report-item .item-statis .icon-statis div.data-values {
  height: 90px;
  display: flex;
  font-size: 0.95em;
}
.report-item .item-statis .icon-statis:last-child {
  border-right: 0px solid #ffffff;
}

.special-item {
  width: 225px !important;
}

.simple-item {
  width: 150px !important;
}

.report-item-subsection {
  width: min-content;
}

.report-item:nth-child(9n+1) {
  background: #b7c6cd;
}

.report-item:nth-child(9n+2) {
  background: #aebfc7;
}

.report-item:nth-child(9n+3) {
  background: #a5b8c1;
  margin-right: 2px;
}

.report-item:nth-child(9n+4) {
  background: #9cb0ba;
  /*margin-left: 1px;*/
}

.report-item:nth-child(9n+5) {
  background: #93a9b4;
}

.report-item:nth-child(9n+6) {
  background: #8aa2ae;
}

.report-item:nth-child(9n+7) {
  background: #819ba8;
}

.report-item:nth-child(9n+8) {
  background: #7794a1;
}

.report-item:nth-child(9n+9) {
  background: #6e8d9b;
}

.HeadersReport {
  font-family: "Trebuchet MS";
  font-stretch: expanded;
  font-size: 15px;
}

.ParentSection {
  padding: 10px 0px 0px 8px !important;
  font-family: "Trebuchet MS";
  font-stretch: expanded;
  font-variant: common-ligatures small-caps;
  font-weight: 550;
  font-size: 16px;
}

.SubSection {
  padding: 10px 0px 0px 8px !important;
  font-family: "Trebuchet MS";
  font-stretch: normal;
  font-size: 14px;
}

.Headersubsection {
  font-family: "Trebuchet MS";
  font-stretch: expanded;
  font-size: 12px;
}

.parentChevron {
  padding: 10px 0px 0px 40px !important;
}

.childChevron {
  padding: 10px 0px 0px 33px !important;
}

#getContents .space-firstlevel {
  padding: 12px 12px 12px 12px !important;
  background-color: #e8e8e8;
}
#getContents .table-firstlevel {
  font-family: "Trebuchet MS";
}
#getContents .collapse.in {
  display: block !important;
}

#getcoursesectiontime .space-secondLevel {
  padding: 0px !important;
}
#getcoursesectiontime .table-secondlevel {
  background-color: #F7F7F7;
  border-radius: 0px;
  border-style: none;
  font-family: "Trebuchet MS";
}
#getcoursesectiontime .collapse.in {
  display: block !important;
}

.time-line-report .Header-Mainsections-time {
  font-family: "Trebuchet MS";
  font-stretch: expanded;
  font-size: 15px;
}
.time-line-report .mainSection-time {
  font-family: "Trebuchet MS";
  font-variant: common-ligatures small-caps;
  font-weight: 550;
  font-size: 16px;
}
.time-line-report .space-students-timeline {
  background-color: #dfdfdf;
  padding: 0px;
  height: 100%;
}
.time-line-report .content-timeline {
  padding: 14px 14px 14px 14px !important;
}
.time-line-report .table-students-timeline {
  font-family: "Trebuchet MS";
  width: 100% !important;
  background-color: #FFFFFF;
  box-shadow: 0px 0px 0px 3px rgb(230, 230, 230);
}
.time-line-report .table-sections-timeline {
  font-family: "Trebuchet MS";
  width: 100% !important;
  background-color: #fdfdfd;
  box-shadow: 0px 0px 0px 3px rgb(217, 217, 217);
}
.time-line-report .space-sections-timeline {
  padding: 10px 12px 12px 12px !important;
  background-color: rgb(230, 230, 230);
}
.time-line-report .table-typeContents-time {
  font-family: "Trebuchet MS";
  width: 100% !important;
}
.time-line-report .space-typeContents-time {
  padding: 0px 8px 0px 8px !important;
  background-color: rgb(217, 217, 217);
}
.time-line-report .table-SessionsColor {
  background-color: #FAFAFA;
}
.time-line-report .space-contentSessions {
  padding: 0px !important;
}
.time-line-report .table-contentSessions {
  width: 100% !important;
  border-radius: 0px;
  border-style: none;
  font-family: "Trebuchet MS";
  background-color: #F5F5F5;
  font-size: 12px;
}
.time-line-report .padding-TypeContent {
  padding-top: 8px;
  padding-bottom: 8px;
}
.time-line-report .padding-Date {
  padding: 8px 0px 8px 10px;
}
.time-line-report .padding-Sessions {
  padding: 8px 0px 8px 11px;
}
.time-line-report .padding-Time {
  padding-left: 16px;
}
.time-line-report .padding-TypeSatus {
  padding-left: 0px;
}
.time-line-report .align-ChevronStudents {
  margin: 13px !important;
  text-decoration: none !important;
}
.time-line-report .align-ChevronSections {
  margin: 22px !important;
  text-decoration: none !important;
}
.time-line-report .align-ChevronContents {
  margin: 28px !important;
  text-decoration: none !important;
}
.time-line-report .label-viewed {
  background: #0088CC !important;
}
.time-line-report .col-minWidth-sections {
  min-width: 500px;
}

.display-none {
  display: none;
}

.containter-time-online h3 {
  font-size: 1.4rem;
  font-weight: bold;
}

table.table-first-level {
  width: 100%;
}
table.table-first-level thead {
  background: #dfdfdf;
}
table.table-first-level .info-view td:first-child {
  width: 25px;
}
table.table-first-level .info-view td:first-child button {
  padding: 2px;
  width: 25px !important;
  height: 25px !important;
}
table.table-first-level .info-view .no-button-border {
  border-bottom: 0;
}
table.table-first-level .info-view .btn-default {
  background: none !important;
  border-color: transparent;
}
table.table-first-level .small-data {
  width: 25px !important;
}
table.table-first-level .info-type {
  width: 80px !important;
}
table.table-first-level .info-avgscore {
  width: 120px !important;
}
table.table-first-level .info-score {
  width: 90px !important;
}
table.table-first-level .row-number {
  width: 25px;
}
table.table-first-level .info-time {
  width: 90px;
}
table.table-first-level .info-attempts {
  width: 90px;
}
table.table-first-level .info-assignment {
  width: 210px;
}
table.table-first-level .info-test {
  width: 90px;
}
table.table-first-level .info-lv1-course {
  width: calc(100% - 415px);
}
table.table-first-level .info-lv1-course-class {
  width: calc(100% - 325px);
}
table.table-first-level .info-lv1-course-class-test {
  width: calc(100% - 415px);
}
table.table-first-level .no-border-top {
  border-top: 0;
}
table.table-first-level .hiddendetails {
  display: none;
}

.internal-level {
  border: 0;
}

.heading-time-online {
  border-bottom: 2px solid #dfdfdf;
}
.heading-time-online .time-filters {
  width: 100%;
  padding-left: 0;
}
@media (min-width: 1612px) {
  .heading-time-online .time-filters {
    margin-top: -15px;
    padding-top: -50px;
    position: absolute;
    padding-right: 45px;
    padding-left: 50px;
  }
  .heading-time-online .time-filters .container-filters {
    width: 66.66666667%;
    float: right;
  }
}
.heading-time-online .btn-type-online {
  margin-top: 10px;
  border-radius: 5px 5px 0 0;
  padding-top: 15px;
  padding-bottom: 12px;
  border-bottom: 0;
}

.bnt-content-type {
  border-radius: 0 0 0 0;
  border-top: 0;
  /*font-weight: bold;*/
  background: none;
  box-shadow: 4px 4px 5px 0px #dfdfdf;
  border: 1px solid #dfdfdf;
}

.height130-p {
  height: 130px;
  position: relative;
}
.height130-p .spinnerloadcontent {
  position: static;
}

.spinnerloadmodal {
  top: 0 !important;
  position: fixed !important;
  opacity: 0.5;
  background: transparent;
}

div.time-online {
  margin-top: -20px !important;
}

.pt-20px {
  padding-top: 20px !important;
}

/*.answer-key {
    -webkit-print-color-adjust: exact;
}*/
@media screen {
  .panel-study-guide {
    margin-bottom: 0;
  }
  .panel-study-guide .yes-print {
    display: none !important;
  }
  .panel-study-guide .panel-heading {
    border-bottom: 0;
    font-size: 13px;
    border-radius: 0px !important;
    color: #000;
  }
  .panel-study-guide .panel-heading .label-title-SG {
    width: 150px;
    font-weight: 700;
    float: left;
  }
  .panel-study-guide .panel-heading h3.title {
    margin: 0;
    font-size: 20px;
  }
  .panel-study-guide .panel-heading .panel-buttons {
    top: 30%;
  }
  .panel-study-guide .panel-body {
    border-radius: 0px !important;
    box-shadow: none !important;
  }
  .panel-study-guide .panel-body .dot-check {
    height: 25px;
    width: 25px;
    background-color: #51b451;
    border-radius: 50%;
    display: inline-block;
  }
  .panel-study-guide .panel-body .dot-cross {
    height: 25px;
    width: 25px;
    background-color: #d2322d;
    border-radius: 50%;
    display: inline-block;
  }
  .panel-study-guide .panel-body .StudyGuide {
    margin-top: 10px;
    width: 100%;
    border: 1px solid #dfdfdf;
    border-collapse: collapse;
  }
  .panel-study-guide .panel-body .StudyGuide td.rn {
    width: 25px !important;
    position: relative;
    border: 1px solid #dfdfdf;
    font-weight: 700;
  }
  .panel-study-guide .panel-body .StudyGuide td.rn span {
    position: absolute;
    top: 15px;
    left: 8px;
  }
  .panel-study-guide .panel-body .StudyGuide td.iscorrect {
    width: 30px !important;
    position: relative;
    border: 1px solid #dfdfdf;
  }
  .panel-study-guide .panel-body .StudyGuide td.iscorrect span, .panel-study-guide .panel-body .StudyGuide td.iscorrect img.img-show {
    position: absolute;
    top: 15px;
    left: 7px;
  }
  .panel-study-guide .panel-body .StudyGuide td.question {
    width: calc(100% - 55px);
    border: 1px solid #dfdfdf;
    padding: 10px;
  }
  .panel-study-guide .panel-body .StudyGuide td.question .question-details {
    width: 100%;
  }
  .panel-study-guide .panel-body .StudyGuide td.question .question-details table.table-annswer-key td, .panel-study-guide .panel-body .StudyGuide td.question .question-details table.table-annswer-key th {
    padding-left: 5px;
    padding-right: 5px;
  }
  .panel-study-guide .panel-body .StudyGuide .label-question {
    width: 100px;
    font-weight: bold;
    position: relative;
  }
  .panel-study-guide .panel-body .StudyGuide .label-question div {
    position: absolute;
    top: 0;
  }
  .panel-study-guide .panel-body .StudyGuide .info-Question {
    width: calc(100% - 100px);
  }
  .panel-study-guide .panel-body .StudyGuide .info-Question p {
    margin-bottom: 0;
  }
  .panel-study-guide .panel-body .StudyGuide .info-Question span {
    font-size: 13px !important;
    line-height: 22px;
  }
  .panel-study-guide .panel-body .StudyGuide .info-Question h4 {
    font-size: 13px !important;
    line-height: 22px;
    margin-top: 0;
    margin-bottom: 0;
  }
  .panel-study-guide .panel-body .StudyGuide .info-Question img {
    position: relative !important;
    margin-bottom: 5px !important;
    max-height: 300px !important;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key {
    margin-top: 5px;
    width: 100%;
    /*border:1px solid #000;*/
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .alert-default {
    background: #FDFDFD;
    padding-top: 10px;
    border-radius: 0;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key {
    width: 100%;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key td.status-answer {
    width: 100px;
    text-align: center;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key td.answer-rn {
    width: 50px;
    text-align: center;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key td.answer-key-colum {
    width: calc(100% - 250px);
    padding-left: 5px;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key td.short-answer-colum {
    width: calc(50% - 250px);
    padding-left: 5px;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key {
    border-collapse: collapse;
    border: 1px solid #000;
    width: 100%;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key td, .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key th {
    border: 1px solid black;
  }
  .panel-study-guide .panel-body .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key td.answer-key-fb {
    width: 33%;
  }
}
@media print {
  .not-print {
    display: none !important;
  }
  .panel-study-guide .panel-heading {
    border-bottom: 0;
    font-size: 13px;
    border-radius: 0px !important;
    color: #FFF;
  }
  .panel-study-guide .panel-heading .label-title-SG {
    width: 150px;
    font-weight: 700;
    float: left;
  }
  .panel-study-guide .panel-heading h3.title {
    margin: 0;
    font-size: 20px;
  }
  .panel-study-guide .panel-heading .panel-buttons {
    top: 30%;
  }
  .table-annswer-key {
    width: 100%;
  }
  .info-Question h4 {
    font-size: 13px !important;
    line-height: 22px;
    margin-top: 0;
    margin-bottom: 0;
  }
  .StudyGuide {
    margin-top: 10px;
    width: 100%;
    border: 1px solid #dfdfdf;
    border-collapse: collapse;
  }
  .StudyGuide td.rn {
    width: 25px !important;
    position: relative;
    border: 1px solid #dfdfdf;
    font-weight: 700;
  }
  .StudyGuide td.rn span {
    position: absolute;
    top: 15px;
    left: 8px;
  }
  .StudyGuide td.iscorrect {
    width: 30px !important;
    position: relative;
    border: 1px solid #dfdfdf;
  }
  .StudyGuide td.iscorrect span, .StudyGuide td.iscorrect img.img-show {
    position: absolute;
    top: 15px;
    left: 7px;
  }
  .StudyGuide td.question {
    width: calc(100% - 55px);
    border: 1px solid #dfdfdf;
    padding: 10px;
  }
  .StudyGuide td.question .question-details {
    width: 100%;
  }
  .StudyGuide td.question .question-details table.table-annswer-key td, .StudyGuide td.question .question-details table.table-annswer-key th {
    padding-left: 5px;
    padding-right: 5px;
  }
  .StudyGuide .label-question {
    width: 100px;
    font-weight: bold;
    position: relative;
  }
  .StudyGuide .label-question div {
    position: absolute;
    top: 0;
  }
  .StudyGuide .info-Question {
    width: calc(100% - 100px);
    height: auto;
  }
  .StudyGuide .info-Question p {
    margin-bottom: 0;
  }
  .StudyGuide .info-Question span {
    font-size: 13px !important;
    line-height: 22px;
  }
  .StudyGuide .info-Question h4 {
    font-size: 13px !important;
    line-height: 22px;
    margin-top: 0;
    margin-bottom: 0;
  }
  .StudyGuide .data-answers-key {
    margin-top: 5px;
    width: 100%;
    /*border:1px solid #000;*/
  }
  .StudyGuide .data-answers-key .alert-default {
    background: #FDFDFD;
    padding-top: 10px;
    border-radius: 0;
  }
  .StudyGuide .data-answers-key .table-annswer-key {
    width: 100%;
  }
  .StudyGuide .data-answers-key .table-annswer-key td.status-answer {
    width: 100px;
    text-align: center;
  }
  .StudyGuide .data-answers-key .table-annswer-key td.answer-rn {
    width: 50px;
    text-align: center;
  }
  .StudyGuide .data-answers-key .table-annswer-key td.answer-key-colum {
    width: calc(100% - 250px);
    padding-left: 5px;
  }
  .StudyGuide .data-answers-key .table-annswer-key td.short-answer-colum {
    width: calc(50% - 250px);
    padding-left: 5px;
  }
  .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key {
    border-collapse: collapse;
    border: 1px solid #000;
    width: 100%;
  }
  .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key td, .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key th {
    border: 1px solid black;
  }
  .StudyGuide .data-answers-key .table-annswer-key table.options-answer-key td.answer-key-fb {
    width: 33%;
  }
}
.filePdf {
  /*page-break-after: inherit;*/
  background: #000;
}
.filePdf .panel-study-guide {
  border: 0 !important;
}
.filePdf .not-print-pdf {
  visibility: hidden !important;
}
.filePdf table.StudyGuide {
  margin-top: 3px;
  /*page-break-after: avoid;*/
}
.filePdf table.StudyGuide td.question div.row div.col-md-12 {
  width: 100% !important;
}

.answer-key-candidate .description-print {
  width: 80% !important;
}
.answer-key-candidate .for-candidate {
  color: #333;
  -webkit-user-select: none;
          user-select: none;
}
.answer-key-candidate .for-candidate td .rn span {
  top: 10px !important;
}
.answer-key-candidate .for-candidate .question-title {
  font-weight: 700;
}
.answer-key-candidate .for-candidate .alert-default {
  color: #333 !important;
}
.answer-key-candidate .for-candidate .question {
  page-break-before: always;
}
.answer-key-candidate .studyGuide-description {
  width: calc(100% - 175px);
}
.answer-key-candidate h4 {
  font-size: 13px;
}
.answer-key-candidate .input-question {
  width: 150px;
  height: 30px;
  padding: 6px 12px;
  font-size: 14px;
  line-height: 1.42857143;
  color: #555;
  background-color: #eee;
  opacity: 1;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 4px;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  transition: border-color ease-in-out 0.15s, box-shadow ease-in-out 0.15s;
}
.answer-key-candidate .input-question-short {
  width: 100%;
  height: 34px;
  padding: 6px 12px;
  font-size: 14px;
  line-height: 1.42857143;
  color: #555;
  background-color: #eee;
  opacity: 1;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 4px;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  transition: border-color ease-in-out 0.15s, box-shadow ease-in-out 0.15s;
}
.answer-key-candidate .option-drag {
  width: 200px;
  padding: 3px 5px 0px 5px;
  min-height: 30px;
}
.answer-key-candidate .option-drag.option-custom-answer {
  height: inherit !important;
}
.answer-key-candidate .option-drag .point-rn {
  word-break: break-all;
  word-break: break-word;
}
.answer-key-candidate .solid-options {
  border: 1px;
  border-style: solid;
  /*color: #000;*/
  margin: 0 0 0 0;
}
.answer-key-candidate .drag-match-options {
  width: 100%;
  display: flex;
}
.answer-key-candidate .drag-match-options .option-drag:first-child {
  margin-right: 100px;
}
.answer-key-candidate .option-custom-answer {
  height: 30px;
  padding: 6px 12px;
  font-size: 14px;
  line-height: 1.42857143;
  color: #555;
  background-color: #eee;
  opacity: 1;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 4px;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  transition: border-color ease-in-out 0.15s, box-shadow ease-in-out 0.15s;
}

.filePdf {
  -webkit-user-select: none;
          user-select: none;
}
.filePdf .description-print {
  width: 80% !important;
}

@media print {
  .answer-key-candidate .description-print {
    width: 80% !important;
  }
  .answer-key-candidate .for-candidate {
    color: #333;
    -webkit-user-select: none;
            user-select: none;
  }
  .answer-key-candidate .for-candidate td .rn span {
    top: 10px !important;
  }
  .answer-key-candidate .for-candidate .question-title {
    font-weight: 700;
  }
  .answer-key-candidate .for-candidate .alert-default {
    color: #333 !important;
  }
  .answer-key-candidate .for-candidate .question {
    page-break-before: always;
  }
  .answer-key-candidate .studyGuide-description {
    width: calc(100% - 175px);
  }
  .answer-key-candidate h4 {
    font-size: 13px;
  }
  .answer-key-candidate .input-question {
    width: 150px;
    height: 30px;
    padding: 6px 12px;
    font-size: 14px;
    line-height: 1.42857143;
    color: #555;
    background-color: #eee;
    opacity: 1;
    background-image: none;
    border: 1px solid #ccc;
    border-radius: 4px;
    box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
    transition: border-color ease-in-out 0.15s, box-shadow ease-in-out 0.15s;
  }
  .answer-key-candidate .input-question-short {
    width: 100%;
    height: 34px;
    padding: 6px 12px;
    font-size: 14px;
    line-height: 1.42857143;
    color: #555;
    background-color: #eee;
    opacity: 1;
    background-image: none;
    border: 1px solid #ccc;
    border-radius: 4px;
    box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
    transition: border-color ease-in-out 0.15s, box-shadow ease-in-out 0.15s;
  }
  .answer-key-candidate .option-drag {
    width: 200px;
    padding: 3px 5px 0px 5px;
    min-height: 30px;
  }
  .answer-key-candidate .option-drag.option-custom-answer {
    height: inherit !important;
  }
  .answer-key-candidate .option-drag .point-rn {
    word-break: break-all;
    word-break: break-word;
  }
  .answer-key-candidate .solid-options {
    border: 1px;
    border-style: solid;
    /*color: #000;*/
    margin: 0 0 0 0;
  }
  .answer-key-candidate .drag-match-options {
    width: 100%;
    display: flex;
  }
  .answer-key-candidate .drag-match-options .option-drag:first-child {
    margin-right: 100px;
  }
  .answer-key-candidate .option-custom-answer {
    height: 30px;
    padding: 6px 12px;
    font-size: 14px;
    line-height: 1.42857143;
    color: #555;
    background-color: #eee;
    opacity: 1;
    background-image: none;
    border: 1px solid #ccc;
    border-radius: 4px;
    box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
    transition: border-color ease-in-out 0.15s, box-shadow ease-in-out 0.15s;
  }
}
.select2-results__option[aria-disabled=true] {
  color: #777;
  cursor: not-allowed;
}

.options-download-preview {
  display: flex;
  justify-content: end;
}

.slider {
  width: 50%;
  margin: 100px auto;
}

.slick-slide {
  margin: 0px 20px;
}

.slick-slide img {
  width: 100%;
}

.slick-prev:before,
.slick-next:before {
  color: black;
}

.slick-slide {
  transition: all ease-in-out 0.3s;
  opacity: 0.2;
}

.slick-active {
  opacity: 0.5;
}

.slick-current {
  opacity: 1;
}

.flashcard .card-flash {
  color: #fff;
  font-size: 2em;
  position: relative;
  text-align: center;
  border-radius: 3px;
  min-height: 250px;
  transition: all 0.5s ease;
  transform-style: preserve-3d;
}
.flashcard .card-flash .card-definition, .flashcard .card-flash .card-concept {
  backface-visibility: hidden;
  position: absolute;
  top: 0;
  left: 0;
  display: flex;
  border-radius: inherit;
  flex-direction: column;
  justify-content: center;
  align-items: center;
  width: 100%;
  height: 100%;
  padding: 40px;
}
.flashcard .card-flash .card-definition {
  background: #5f8de2;
  background: linear-gradient(5deg, #3fb3e9, #5f8de2);
  z-index: 2;
  transform: rotateX(0deg);
}
.flashcard .card-flash .card-concept {
  background: #f38961;
  background: linear-gradient(5deg, #fb404b, #f38961);
  transform: rotateX(180deg);
  margin: 0;
}
.flashcard .card-flash .card-concept:before {
  content: attr(part) ".";
  font-style: italic;
  font-size: 0.8em;
  opacity: 0.7;
}
.flashcard [class*=-slide] {
  transition: all 0.5s ease;
  transform: scale(1);
  perspective: 1500px;
  margin: 40px 25px;
  outline: none;
  opacity: 0.8;
}
.flashcard [class*=-current] {
  transform: scale(1.1);
  cursor: pointer;
  opacity: 1;
}
.flashcard [class*=-current] .flip {
  transform: rotateX(180deg);
}

html.overflow-y-auto {
  overflow-y: auto !important;
}

body.body-gkan-blue {
  position: relative;
}
body.body-gkan-blue:before {
  content: "";
  position: absolute;
  top: 0;
  left: 0;
  width: 100%;
  height: 100%;
  background-image: url("/css/images/background_login.png");
  background-size: cover;
  background-position: 50% 50%;
  background-repeat: no-repeat;
  filter: opacity(0.3);
}
@media only screen and (max-width: 1200px) {
  body.body-gkan-blue:before {
    background-size: auto;
  }
}
body.body-gkan-blue .body-sign .panel-sign .panel-body {
  border-top-color: #0099E6;
}
body.body-gkan-blue .btn-primary {
  border-color: transparent;
}

.panel-message-cookies {
  max-width: 80% !important;
  padding-top: 0 !important;
}
.panel-message-cookies .title {
  font-weight: bold;
  font-size: 15px;
  margin-bottom: 3px;
}

.CookieMessage {
  position: fixed;
  bottom: 0;
  left: 0;
  right: 0;
  background: rgba(0, 0, 0, 0.85);
  z-index: 10000;
  display: none;
}

.CookieMessage-content {
  color: white;
  width: 70%;
  margin: 0 0 5px 0;
  padding: 20px 20px 0 20px;
  font-family: sans-serif;
  line-height: 1.5;
  font-size: 12px;
  float: left;
}
.CookieMessage-content a {
  font-weight: bold;
  color: white;
}
.CookieMessage-content p {
  margin: 0 0 5px 0;
  padding-left: 25%;
}

.Cookiebutton-content {
  width: 30%;
  float: left;
}
.Cookiebutton-content a {
  margin-top: 20px;
  color: white;
}

.CookieMessage-button {
  background: rgba(0, 0, 0, 0.85);
  display: inline-block;
  text-decoration: none;
  padding: 5px 20px;
  border-radius: 5px;
}
.CookieMessage-button:hover {
  background: #0092F2;
}

.body-register-extend .extend-register .form-wizard {
  width: 600px;
}
.body-register-extend .extend-register .form-wizard .progress-indicator {
  width: 0%;
}
.body-register-extend .extend-register .w-80 {
  display: inline;
  width: 70px;
}
.body-register-extend .extend-register .break-word {
  word-wrap: break-word;
}

.overview-license {
  width: 100%;
  display: flex;
  flex-wrap: wrap;
  height: auto !important;
}
.overview-license .overview-info {
  width: 250px;
  display: flex;
  flex-wrap: nowrap;
  align-content: flex-start;
  border-radius: 8px;
  box-shadow: 5px 5px 8px #666;
  margin-bottom: 15px;
  margin-right: 20px;
}
.overview-license .overview-info div {
  height: 100%;
}
.overview-license .overview-info div:nth-child(1) {
  padding-top: 20px;
  padding-left: 15px;
  padding-bottom: 20px;
  padding-right: 10px;
  font-size: 55px;
  color: #fff;
  width: 82px;
}
.overview-license .overview-info div:nth-child(2) {
  padding-left: 0px;
  padding-top: 25px;
  width: calc(100% - 85px);
}
.overview-license .overview-info div:nth-child(2) p {
  color: #ffffff;
  width: 100%;
}
.overview-license .overview-info div:nth-child(2) .counter {
  margin-bottom: 8px;
  font-size: 25px;
  font-weight: 500;
}
.overview-license .overview-info div:nth-child(2) .label-counter {
  margin-bottom: 0;
  font-size: 13px;
  line-height: 15px;
}
.overview-license .course {
  background: #5D398A;
}
.overview-license .test {
  background: #00A0DE;
}
.overview-license .user {
  background: #92C353;
}
.overview-license .organization {
  background: #666666;
}

@media (max-width: 1560px) {
  .overview-license .overview-info {
    width: 225px !important;
  }
}
.content-enrollment {
  display: flex;
  justify-content: center;
  flex-wrap: wrap;
}
.content-enrollment .data-enrollment {
  width: 60px;
  display: flex;
  align-content: flex-start;
}
.content-enrollment .status-enrollment {
  width: 50px;
}
.content-enrollment .status-enrollment .label {
  display: block;
  width: 55px !important;
}

.option-licensing, .licensing-days-left {
  width: 50px;
}

.table-licensing td {
  vertical-align: inherit !important;
}

@media (max-width: 1370px) {
  .table-licensing .split-column {
    width: 90px;
    padding-right: 8px !important;
  }
  .table-licensing .split-column .data-enrollment {
    justify-content: center;
  }
  .table-licensing .split-column .label {
    margin-top: 3px;
  }
}
ul.licenses-tab li a:hover, ul.licenses-tab li a:focus {
  color: #555 !important;
  border-bottom: 3px solid #555 !important;
}
ul.licenses-tab li.active a:hover, ul.licenses-tab li.active a:focus {
  color: #555 !important;
  border-bottom: 3px solid #555 !important;
}

#orgselected th.sortable::after {
  content: " ⇅";
  font-size: 1.2em;
  color: #aaa;
  margin-left: 5px;
}

#orgselected th.asc::after {
  content: " ▲";
  color: #333;
}

#orgselected th.desc::after {
  content: " ▼";
  color: #333;
}

.cursor-pointer {
  cursor: pointer;
}

.custom-profile .profile-item {
  border-color: #E6E6E6 !important;
  border-left-width: 1px;
  border-left-style: solid;
  border-top-width: 1px;
  border-top-style: solid;
  border-right-width: 1px;
  border-right-style: solid;
  border-bottom-width: 1px;
  border-bottom-style: solid;
}
.custom-profile .profile-item .h5 {
  color: black;
}
.custom-profile .border-top-none {
  border-top-width: 0px;
}
.custom-profile .rounded-top {
  border-top-left-radius: 0.375rem !important;
  border-top-right-radius: 0.375rem !important;
}
.custom-profile .rounded-bottom {
  border-bottom-left-radius: 0.375rem !important;
  border-bottom-right-radius: 0.375rem !important;
}
.custom-profile .spacing {
  margin-top: 20px;
}
.custom-profile .a-cancel {
  font-size: 14px;
  text-decoration: underline;
}
.custom-profile .delete-instructions {
  line-height: 20px;
}
.custom-profile .delete-title {
  font-size: 1.7rem;
}

.manage-class ul.nav-tabs li.nav-item a:hover {
  color: black !important;
  border-bottom: none !important;
}
.manage-class ul.nav-tabs li.nav-item a:focus {
  color: black !important;
}
.manage-class .active-filter {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}

.a-cancel {
  font-size: 14px;
  text-decoration: underline;
}

.half-rule {
  height: 1px;
  width: 100%;
  display: block; /* for use on default inline elements like span */
  margin: 3px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}

.a-table-action {
  text-decoration: none;
  color: #777;
  cursor: pointer;
}
.a-table-action:hover {
  text-decoration: none;
  color: #777;
  cursor: pointer;
}

.dialog {
  z-index: 999999;
  position: fixed;
  left: 0;
  top: 0;
  width: 100%;
  min-width: 100%;
  height: auto !important;
  min-height: 100%;
  background: rgba(81, 73, 73, 0.6);
}
.dialog .container {
  position: relative;
}
.dialog .container .dialog-panel {
  border: 1px solid #dee2e6;
  border-radius: 0.25rem;
  margin: 20px;
}
.dialog .container .dialog-panel-heading, .dialog .container .dialog-panel-footer {
  padding: 10px;
  background-color: #f8f9fa;
  border-bottom: 1px solid #dee2e6;
  border-radius: 0.25rem 0.25rem 0 0;
}
.dialog .container .dialog-panel-footer {
  border-top: 1px solid #dee2e6;
  border-radius: 0 0 0.25rem 0.25rem;
}
.dialog .container .dialog-panel-body {
  height: calc(100vh - 180px);
  overflow-y: scroll;
  padding: 10px;
}

.table-borderless {
  /* Sobrescribir estilos de Bootstrap para tabla sin bordes */
}
.table-borderless .table {
  border-collapse: collapse; /* colapsa los bordes de la tabla */
  width: 100%;
  border: none; /* elimina el borde de la tabla */
}
.table-borderless .table th,
.table-borderless .table td {
  border: none; /* elimina el borde de las celdas */
  padding: 8px; /* añade espaciado entre celdas */
  text-align: left; /* alineación del texto */
}
.table-borderless .table-striped > tbody > tr:nth-of-type(odd) {
  background-color: #f9f9f9; /* color de fondo alternado */
}
.table-borderless .table-striped > tbody > tr {
  border: none; /* elimina el borde de las filas */
}
.table-borderless .table-title {
  width: 40px;
}
.table-borderless .table-title-x2 {
  width: 150px;
}
.table-borderless .table-title-x3 {
  width: 200px;
}
.table-borderless td.step {
  border-bottom: none;
  font-size: 16px;
}
.table-borderless ul {
  padding-left: 10px !important;
}

.ml-0px {
  margin-left: 0px !important;
}

.modal-upper-position {
  z-index: 99999999 !important;
}

.label-microsoft {
  background: #00a4ef;
  color: #FFF;
  display: inline;
}

.label-google {
  background: #e33e2b;
  color: #FFF;
  display: inline;
}

.label-lti {
  background: #b434eb;
  color: #FFF;
  display: inline;
}

.label-undefined {
  background: #5d5b5e;
  color: #FFF;
  display: inline;
}

.label-local {
  background: #5D398A;
  color: #FFF;
  display: inline;
}

.label-corrupted {
  background: #ecb511;
  color: #FFF;
  display: inline;
}

.label-unknow {
  background: #0f0f0e;
  color: #FFF;
  display: inline;
}

.label-last-access {
  display: block;
}

.label-container {
  display: inherit;
}
.label-container.label-success {
  display: inline;
}

.label-disabled {
  background: #ebebeb;
  color: #000;
}

.label-locked {
  background: #fff;
  color: #d2322d;
  border: 1px solid #d2322d;
}

.label-course {
  background: #8559bb;
  color: #fff;
}

.label-test {
  background: #2bc5ff;
  color: #fff;
}

.label-Administrator {
  background: #343a40 !important;
  color: #fff;
}

.label-Instructor {
  background: #6c757d !important;
  color: #fff;
}

.multiple-steps-component .contenedor {
  display: flex;
  flex-wrap: wrap;
}
.multiple-steps-component .columna1 {
  flex: 0;
}
.multiple-steps-component .columna2 {
  flex: 13;
}

.btn-never-access {
  border-radius: 3px !important;
  border-color: #fff;
  background-color: #fff;
  color: #333;
  border-color: #ccc;
}
.btn-never-access:hover {
  color: #333;
  text-decoration: none;
}
.btn-never-access:focus {
  color: #333;
  text-decoration: none;
}

.btn-in-progress {
  border-radius: 3px !important;
  color: #333;
  background-color: #e7e7e7;
}
.btn-in-progress:hover {
  color: #333;
  text-decoration: none;
}
.btn-in-progress:focus {
  color: #333;
  text-decoration: none;
}

.btn-pass {
  border-radius: 3px !important;
  border-color: #1cba63;
  background-color: #1cba63;
  border-color: #1cba63 #1cba63 #158e4b;
  color: #FFF;
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
}
.btn-pass:hover {
  color: #fff;
  text-decoration: none;
}
.btn-pass:focus {
  color: #fff;
  text-decoration: none;
}

.btn-needs-work {
  border-radius: 3px !important;
  border-color: #d2322d;
  background-color: #d2322d;
  border-color: #d2322d #d2322d #a82824;
  color: #FFF;
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
}
.btn-needs-work:hover {
  color: #fff;
  text-decoration: none;
}
.btn-needs-work:focus {
  color: #fff;
  text-decoration: none;
}

.btn-submitted {
  border-radius: 3px !important;
  background-color: #0088CC;
  border-color: #0088CC #0088CC #006699;
  color: #FFF;
}
.btn-submitted:hover {
  color: #fff;
  text-decoration: none;
}
.btn-submitted:focus {
  color: #fff;
  text-decoration: none;
}

.btn-block-custom {
  display: block;
  width: 75%;
}

.border.right-color-white {
  border-right-color: white !important;
}

.border-left-color-white {
  border-left-color: white !important;
}

.items-to-center {
  display: flex;
  align-items: center;
  justify-content: center;
}

.gb-container-title {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
  /*.gb-switch-view {
      display: flex;
      flex-wrap: wrap;
      flex-direction: column;

      span {
          display: flex;
      }
  }*/
}
.gb-container-title .custom-titles {
  display: flex;
  flex-direction: row;
  justify-content: flex-start;
}
.gb-container-title .custom-titles .disabled-option, .gb-container-title .custom-titles .gb-title, .gb-container-title .custom-titles .edit-title {
  display: flex;
  flex-direction: row;
  align-items: flex-start;
}
.gb-container-title .content-in-lesson {
  padding-left: 90px;
}

.container-download-resource {
  display: flex;
  align-items: center;
}

.instructor-resources ul {
  list-style-type: none;
  padding-left: 0;
}
.instructor-resources ul .check-download-resource {
  margin-right: 10px;
}

.ir-options-donwload {
  display: flex;
  justify-content: space-between;
  margin-bottom: 10px;
}

/*@import "modules/custom/lost-page.scss";*/
.userway {
  top: 8px !important;
}

.userway-s3-2 .header {
  background: #000 !important;
}
.userway-s3-2 .header .dropdown-menu {
  background: #000 !important;
}
.userway-s3-2 .inner-wrapper {
  background: #262626 !important;
}
.userway-s3-2 .card-goto,
.userway-s3-2 .panel-overlay.awards {
  border: 1px solid #50d0a0 !important;
}
.userway-s3-2 .header-course-progress-bar {
  background-color: #fff !important;
}
.userway-s3-2 .header-course-progress-bar .header-course-progress-bar-indicator {
  background-color: gray !important;
}
.userway-s3-2 .circular-bar-chart {
  background-color: #333333 !important;
  border-radius: 100px;
}
.userway-s3-2 .circular-bar-chart canvas {
  vertical-align: middle !important;
}
.userway-s3-2 .circular-bar-chart label {
  background-color: transparent !important;
}
.userway-s3-2 .circular-bar-chart label span {
  background-color: transparent !important;
}
.userway-s3-2 .course-taking .sidebar-left {
  background-color: #0d0d0d !important;
}
.userway-s3-2 .course-taking .sidebar-left .nano {
  border-right-color: #fff !important;
  border-right-width: 1px;
  border-right-style: solid;
}
.userway-s3-2 .course-taking .sidebar-left .nano-content {
  background: #0d0d0d !important;
}
.userway-s3-2 .course-taking .sidebar-left .nano-content .nav-main {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .course-taking .sidebar-left .nano-pane {
  background-color: #50d0a0 !important;
}
.userway-s3-2 .course-taking .sidebar-left .nano-pane .nano-slider {
  background-color: #124230;
}
.userway-s3-2 .course-taking .vjs-progress-control .vjs-load-progress {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .course-taking .vjs-progress-control .vjs-play-progress {
  background-color: #fff !important;
}
.userway-s3-2 .course-taking .completion .progress {
  background-color: #666666 !important;
}
.userway-s3-2 .course-taking .completion .progress .progress-bar {
  background-color: #fff !important;
}
.userway-s3-2 .course-taking .gallery-evidence ul li {
  border: 1px solid #50d0a0 !important;
}
.userway-s3-2 .course-taking .notes-activity .row-conversation {
  border: 1px solid #50d0a0 !important;
}
.userway-s3-2 .test-runner-course #question-content .call-to-action-top,
.userway-s3-2 .container-take-test #question-content .call-to-action-top {
  background-color: rgba(0, 0, 0, 0) !important;
  border-bottom: 1px solid #8ce0c1 !important;
}
.userway-s3-2 .test-runner-course #question-content .call-to-action-top button,
.userway-s3-2 .container-take-test #question-content .call-to-action-top button {
  background-color: rgba(0, 0, 0, 0) !important;
  border: 1px solid #8ce0c1 !important;
}
.userway-s3-2 .test-runner-course .panel-questions,
.userway-s3-2 .container-take-test .panel-questions {
  border: 1px solid #50d0a0 !important;
}
.userway-s3-2 .test-runner-course .panel-questions .input-group-answers,
.userway-s3-2 .container-take-test .panel-questions .input-group-answers {
  border: 1px solid #50d0a0 !important;
}
.userway-s3-2 .test-runner-course .panel-questions .input-group-answers input:checked ~ label:before,
.userway-s3-2 .container-take-test .panel-questions .input-group-answers input:checked ~ label:before {
  background-color: #1d6a4d !important;
}
.userway-s3-2 .test-runner-course .panel-questions .input-group-answers input:checked ~ label:after,
.userway-s3-2 .container-take-test .panel-questions .input-group-answers input:checked ~ label:after {
  background-color: #8ce0c1 !important;
  border-color: #8ce0c1 !important;
}
.userway-s3-2 .test-runner-course .panel-questions .btn-warning,
.userway-s3-2 .container-take-test .panel-questions .btn-warning {
  background-color: #ed9c28 !important;
}
.userway-s3-2 .test-runner-course .panel-questions .btn-warning i,
.userway-s3-2 .container-take-test .panel-questions .btn-warning i {
  background-color: rgba(0, 0, 0, 0) !important;
  color: #000 !important;
}
.userway-s3-2 .panel-overlay .panel-heading {
  border: 1px solid #FFF !important;
}
.userway-s3-2 .panel-overlay .panel-heading .header-texts {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .panel-overlay .panel-heading .header-texts h4 {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .jconfirm-box {
  border: 1px solid #50d0a0 !important;
  border-top: 7px solid #50d0a0 !important;
  animation: none !important;
}
.userway-s3-2 .jconfirm-box button {
  border: 1px solid #50d0a0 !important;
}
.userway-s3-2 .page-header .breadcrumbs li {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .page-header .breadcrumbs li .ui-popover-wrapper {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .page-header .breadcrumbs .timer-color {
  background: #1d6a4d !important;
}
.userway-s3-2 .page-header .breadcrumbs .timer-color span {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs {
  border-bottom: 1px solid #50d0a0 !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li > a {
  border-left: 1px solid #50d0a0 !important;
  border-right: 1px solid #50d0a0 !important;
  border-top: 1px solid #50d0a0 !important;
  border-bottom: 3px solid #000 !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li.active a {
  border-left: 1px solid #50d0a0 !important;
  border-right: 1px solid #50d0a0 !important;
  border-top: 1px solid #50d0a0 !important;
  border-bottom: 3px solid #50d0a0 !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content {
  border-color: #50d0a0 !important;
  border-top: 1px solid #50d0a0 !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td .label-warning {
  background-color: #f0ad4e !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td .label-success {
  background-color: #47a447 !important;
}
.userway-s3-2 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td span {
  color: #000 !important;
}
.userway-s3-2 .panel-body, .userway-s3-2 .form-control, .userway-s3-2 .btn-primary {
  background-color: rgb(0, 0, 0) !important;
}
.userway-s3-2 .btn-primary {
  border-color: rgb(255, 255, 255) !important;
}

.userway-s3-3 .userway {
  background-color: #000 !important;
}
.userway-s3-3 .header {
  background: #FFF !important;
}
.userway-s3-3 .header .dropdown-menu {
  background: #FFF !important;
}
.userway-s3-3 .inner-wrapper {
  background: #d9d9d9 !important;
}
.userway-s3-3 .card-goto {
  border: 1px solid #000 !important;
}
.userway-s3-3 .header-course-progress-bar {
  background-color: #000 !important;
}
.userway-s3-3 .header-course-progress-bar .header-course-progress-bar-indicator {
  background-color: gray !important;
}
.userway-s3-3 .circular-bar-chart {
  background-color: #cccccc !important;
  border-radius: 100px;
}
.userway-s3-3 .circular-bar-chart canvas {
  vertical-align: middle !important;
}
.userway-s3-3 .circular-bar-chart label {
  background-color: transparent !important;
}
.userway-s3-3 .circular-bar-chart label span {
  background-color: transparent !important;
}
.userway-s3-3 .course-taking .sidebar-left {
  background-color: white !important;
}
.userway-s3-3 .course-taking .sidebar-left .nano {
  border-right-color: #000 !important;
  border-right-width: 1px;
  border-right-style: solid;
}
.userway-s3-3 .course-taking .sidebar-left .nano-content {
  background: #fff !important;
}
.userway-s3-3 .course-taking .sidebar-left .nano-content .nav-main {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .course-taking .sidebar-left .nano-pane {
  background-color: #cecece !important;
}
.userway-s3-3 .course-taking .sidebar-left .nano-pane .nano-slider {
  background-color: #686868;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a {
  background: #fff !important;
  color: #000 !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:hover, .userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:focus {
  background: #e6e6e6 !important;
  color: #0d0d0d !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:hover i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:hover span, .userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:focus i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:focus span {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:hover i i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:hover span i, .userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:focus i i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > a:focus span i {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a {
  background: #fff !important;
  color: #000 !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:hover, .userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:focus {
  background: #e6e6e6 !important;
  color: #0d0d0d !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:hover i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:hover span, .userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:focus i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:focus span {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:hover i i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:hover span i, .userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:focus i i,
.userway-s3-3 .course-taking .sidebar-left ul.nav-main > li > ul.nav-children li a:focus span i {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .course-taking .sidebar-left .sidebar-header .sidebar-title {
  background: #fff !important;
  color: #000 !important;
}
.userway-s3-3 .course-taking .sidebar-left .sidebar-header .sidebar-toggle {
  background: #fff !important;
}
.userway-s3-3 .course-taking .vjs-control-bar {
  background-image: none !important;
}
.userway-s3-3 .course-taking .vjs-progress-control .vjs-load-progress {
  background-color: #cecece !important;
}
.userway-s3-3 .course-taking .vjs-progress-control .vjs-play-progress {
  background-color: #000 !important;
}
.userway-s3-3 .course-taking .completion .progress-bar progress-bar-success {
  background-color: #cecece !important;
}
.userway-s3-3 .course-taking .gallery-evidence ul li {
  border: 1px solid #cecece !important;
}
.userway-s3-3 .course-taking .notes-activity .row-conversation {
  border: 1px solid #cecece !important;
}
.userway-s3-3 .test-runner-course #question-content .call-to-action-top,
.userway-s3-3 .container-take-test #question-content .call-to-action-top {
  background-color: rgba(0, 0, 0, 0) !important;
  border-bottom: 1px solid #cecece !important;
}
.userway-s3-3 .test-runner-course #question-content .call-to-action-top button,
.userway-s3-3 .container-take-test #question-content .call-to-action-top button {
  background-color: rgba(0, 0, 0, 0) !important;
  border: 1px solid #cecece !important;
}
.userway-s3-3 .test-runner-course .panel-questions,
.userway-s3-3 .container-take-test .panel-questions {
  border: 1px solid #cecece !important;
}
.userway-s3-3 .test-runner-course .panel-questions .input-group-answers,
.userway-s3-3 .container-take-test .panel-questions .input-group-answers {
  border: 1px solid #cecece !important;
}
.userway-s3-3 .test-runner-course .panel-questions .input-group-answers input:checked ~ label::before,
.userway-s3-3 .container-take-test .panel-questions .input-group-answers input:checked ~ label::before {
  background-color: #1d6a4d !important;
}
.userway-s3-3 .test-runner-course .panel-questions .input-group-answers input:checked ~ label:after,
.userway-s3-3 .container-take-test .panel-questions .input-group-answers input:checked ~ label:after {
  background-color: #8ce0c1 !important;
  border-color: #8ce0c1 !important;
}
.userway-s3-3 .test-runner-course .panel-questions .btn-warning,
.userway-s3-3 .container-take-test .panel-questions .btn-warning {
  background-color: #ed9c28 !important;
}
.userway-s3-3 .test-runner-course .panel-questions .btn-warning i,
.userway-s3-3 .container-take-test .panel-questions .btn-warning i {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .panel-overlay .panel-heading {
  border: 1px solid #000 !important;
}
.userway-s3-3 .panel-overlay .panel-heading .header-texts {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .panel-overlay .panel-heading .header-texts h4 {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .jconfirm-box {
  border: 1px solid #cecece !important;
  border-top: 7px solid #cecece !important;
  animation: none !important;
}
.userway-s3-3 .jconfirm-box button {
  border: 1px solid #cecece !important;
}
.userway-s3-3 .page-header .breadcrumbs li {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .page-header .breadcrumbs li .ui-popover-wrapper {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .page-header .breadcrumbs .timer-color {
  background: #1d6a4d !important;
}
.userway-s3-3 .page-header .breadcrumbs .timer-color span {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .page-preview .header-banner {
  background: #fff !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs {
  border-bottom: 1px solid #cecece !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li > a {
  border-left: 1px solid #cecece !important;
  border-right: 1px solid #cecece !important;
  border-top: 1px solid #cecece !important;
  border-bottom: 3px solid #fff !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > ul.nav-tabs > li.active a {
  border-left: 1px solid #cecece !important;
  border-right: 1px solid #cecece !important;
  border-top: 1px solid #cecece !important;
  border-bottom: 3px solid #cecece !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content {
  border-color: #cecece !important;
  border-top: 1px solid #cecece !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td .label-warning {
  background-color: #f0ad4e !important;
}
.userway-s3-3 .course-html .scrolling-tabs-wrapper > .scrollable-tabs > .tab-content table tbody td .label-success {
  background-color: #47a447 !important;
}

.userway-s3-2 .row:not(.header-course-dashboard),
.userway-s3-3 .row:not(.header-course-dashboard) {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .row:not(.header-course-dashboard) > div,
.userway-s3-3 .row:not(.header-course-dashboard) > div {
  background: transparent !important;
}
.userway-s3-2 .home-student,
.userway-s3-3 .home-student {
  padding: 0 15px;
}
.userway-s3-2 .home-student .cards-in-home,
.userway-s3-3 .home-student .cards-in-home {
  padding: 0 10px;
}
.userway-s3-2 #container-view,
.userway-s3-3 #container-view {
  padding: 0 5px;
}
.userway-s3-2 .tabs-dashboard-contanier,
.userway-s3-3 .tabs-dashboard-contanier {
  background: transparent !important;
}
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom {
  background: transparent !important;
}
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .nav-tabs,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .nav-tabs {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .nav-tabs li.active a,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .nav-tabs li.active a {
  border-color: #3d9de1 !important;
}
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-content,
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-resources,
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-bookmarks,
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-glossary,
.userway-s3-2 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-session,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-content,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-resources,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-bookmarks,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-glossary,
.userway-s3-3 .tabs-dashboard-contanier .tabs-bottom .tab-content .crs-session {
  padding: 15px !important;
}
.userway-s3-2 .course-taking .sidebar-toggle i,
.userway-s3-3 .course-taking .sidebar-toggle i {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .retake-principal-container .circular-bar-chart,
.userway-s3-3 .retake-principal-container .circular-bar-chart {
  margin: 0 auto;
  width: 120px;
}
.userway-s3-2 .course-html .home-container .panel-body,
.userway-s3-3 .course-html .home-container .panel-body {
  background: transparent !important;
}
.userway-s3-2 i.caret,
.userway-s3-3 i.caret {
  border-right: 4px solid transparent !important;
  border-left: 4px solid transparent !important;
}
.userway-s3-2 .jconfirm-open,
.userway-s3-3 .jconfirm-open {
  background-color: rgba(0, 0, 0, 0) !important;
}
.userway-s3-2 .jconfirm-open *:not(.jconfirm-box),
.userway-s3-3 .jconfirm-open *:not(.jconfirm-box) {
  background-color: rgba(0, 0, 0, 0) !important;
}

.userway-s6:not(.userway-s3-2):not(.userway-s3-3) .panel-body.b-gray {
  border: 0px !important;
}
.userway-s6 .nav-link {
  text-decoration: none !important;
  color: #0088CC !important;
  background-color: transparent !important;
}
.userway-s6 .nav-link * {
  text-decoration: none !important;
  color: #0088CC !important;
  background-color: transparent !important;
}
.userway-s6 .scrolling-tabs-wrapper .nav-link {
  text-decoration: underline !important;
  color: #ff0 !important;
  background-color: #000 !important;
}
.userway-s6 .scrolling-tabs-wrapper .nav-link * {
  text-decoration: underline !important;
  color: #ff0 !important;
  background-color: #000 !important;
}
.userway-s6 .scrolling-tabs-bg-none > .scrollable-tabs > .nav-tabs > li > a {
  text-decoration: underline !important;
  color: #ff0 !important;
  background-color: #000 !important;
}
.userway-s6 ol.breadcrumbs li a {
  text-decoration: none !important;
  color: #fff !important;
  background-color: transparent !important;
}
.userway-s6 ol.breadcrumbs li a * {
  text-decoration: none !important;
  color: #fff !important;
  background-color: transparent !important;
}
.userway-s6.userway-s3-3 ol.breadcrumbs li a {
  color: #000 !important;
}
.userway-s6.userway-s3-3 ol.breadcrumbs li a * {
  color: #000 !important;
}
.userway-s6 a.rolestitle {
  text-decoration: none !important;
  color: #0088CC !important;
  background-color: transparent !important;
}
.userway-s6 a.rolestitle span {
  text-decoration: none !important;
  color: #fff !important;
  background-color: transparent !important;
}
.userway-s6 a.rolestitle span i {
  text-decoration: none !important;
  color: #fff !important;
  background-color: transparent !important;
}

.dropdown-menu.myroles {
  margin-top: 55px !important;
  padding-top: 0px !important;
  margin-left: 5px !important;
}

.flip-effect-container a {
  text-decoration: none !important;
}

table.table-student td div i:hover {
  color: #000;
  font-weight: 900;
}

.accessibility-menu {
  margin: 0px 10px 0 0 !important;
}
.accessibility-menu element.style {
  position: absolute;
  right: 55px;
  top: 10px;
}
@media only screen and (max-width: 767px) {
  .accessibility-menu {
    right: 65px;
    top: 10px;
    position: absolute;
  }
}
.accessibility-menu .row {
  line-height: 22px !important;
}
.accessibility-menu span {
  color: #777 !important;
  line-height: 22px !important;
}
.accessibility-menu .accessibility-icon {
  font-size: 40px;
  color: #5CB85C;
  background: #fff;
  border-radius: 50px;
  cursor: pointer;
}
.accessibility-menu .accessibility-dropdown-menu {
  margin: 0 5px !important;
  padding: 10px 5px !important;
  background: #ffffff !important;
  left: -220px !important;
  width: 250px !important;
  top: 45px !important;
}
.accessibility-menu .accessibility-dropdown-menu .row {
  margin: 0 5px;
}
.accessibility-menu .accessibility-dropdown-menu .row .col-md-6, .accessibility-menu .accessibility-dropdown-menu .row .col-md-12 {
  padding: 5px;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action {
  padding: 5px;
  border: 1px solid #e3e6e9;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action:not(.reset) {
  height: 65px;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.close {
  margin-top: -10px;
  height: 15px !important;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.close:hover {
  border: 1px solid #e3e6e9 !important;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action div {
  width: 100%;
  text-align: center;
  /*&:nth-child(-n+2){
      height :18px;
  }*/
}
.accessibility-menu .accessibility-dropdown-menu .ally-action:hover {
  border: 1px solid #000;
  background: #f7f8f9;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.action-active {
  border: 1px solid #3d9de1;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.action-active.intensity-1 .mark:nth-child(-n+1) {
  background: #3d9de1;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.action-active.intensity-2 .mark:nth-child(-n+2) {
  background: #3d9de1;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.action-active.intensity-3 .mark:nth-child(-n+3) {
  background: #3d9de1;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action.action-active.intensity-4 .mark:nth-child(-n+4) {
  background: #3d9de1;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action .level, .accessibility-menu .accessibility-dropdown-menu .ally-action .level2 {
  margin-top: -10px;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action .level .mark, .accessibility-menu .accessibility-dropdown-menu .ally-action .level2 .mark {
  width: 20% !important;
  height: 3px;
  display: inline-block;
  border-radius: 4px;
}
.accessibility-menu .accessibility-dropdown-menu .ally-action .level2 .mark {
  width: 45% !important;
}

.userway-s3-2 .intensity-1 .mark:nth-child(-n+1) {
  background: #50d0a0 !important;
}
.userway-s3-2 .intensity-2 .mark:nth-child(-n+2) {
  background: #50d0a0 !important;
}

.userway-s3-3 .intensity-1 .mark:nth-child(-n+1) {
  background: #000 !important;
}
.userway-s3-3 .intensity-2 .mark:nth-child(-n+2) {
  background: #000 !important;
}
.userway-s3-3 .intensity-3 .mark:nth-child(-n+3) {
  background: #000 !important;
}

@font-face {
  font-family: Minecraftia;
  src: url(data:font/truetype;base64,AAEAAAANAIAAAwBQRkZUTV/JAIgAAEcgAAAAHEdERUYBAwAkAABG+AAAAChPUy8yZsMzdwAAAVgAAABgY21hcG6etckAAAUIAAABomdhc3D//wADAABG8AAAAAhnbHlmwglSaQAACFgAADdYaGVhZPk9cqMAAADcAAAANmhoZWEIgwHUAAABFAAAACRobXR4OJ0AAAAAAbgAAANObG9jYaVll4IAAAasAAABqm1heHAA3wAqAAABOAAAACBuYW1lJ/FDLgAAP7AAAAUTcG9zdNmblGkAAETEAAACKwABAAAAAQAA+92lvl8PPPUACwQAAAAAAMtPFtMAAAAAy08W0/+A/wAEAAUAAAAACAACAAAAAAAAAAEAAAUA/wAAAASA/4D9gAQAAAEAAAAAAAAAAAAAAAAAAADTAAEAAADUACgACgAAAAAAAgAAAAAAAAAAAAAAAAAAAAAAAgKpAZAABQAEAgACAAAA/8ACAAIAAAACAAAzAMwAAAAABAAAAAAAAACgAAAHQAAACgAAAAAAAAAARlNUUgBAACD7AgOA/4AAAAUAAQAAAAH7AAAAAAKAA4AAAAAgAAEBAAAAAAAAAAKOAAACjgAAAQAAAAKAAAADAAAAAwAAAAMAAAADAAAAAYAAAAKAAAACgAAAAoAAAAMAAAABAAAAAwAAAAEAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAEAAAABAAAAAoAAAAMAAAACgAAAAwAAAAOAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAIAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAIAAAADAAAAAgAAAAMAAAADAAAAAYAAAAMAAAADAAAAAwAAAAMAAAADAAAAAoAAAAMAAAADAAAAAQAAAAMAAAACgAAAAYAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAACAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAoAAAAEAAAACgAAAA4AAAAEAAAADAAAAAwAAAAKAAAADAAAAAQAAAAKAAAADAAAAA4AAAAIAAAADAAAAAwAAAAMAAAADgAAAAwAAAAIAAAADgAAAAoAAAAKAAAABgAAABAAAAASAAAABgAAAAgAAAAGAAAACAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAABgAAAAgAAgAIAAAACAAAAAwD/gAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAACgAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAGAAAABgAAAAQAAAAIAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAA4AAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAIAAAADAAAAAwAAAAMAAAADAAAAAYAAAAGAAAABgAAAAYAAAAKAAAACgAAAAoAAAAMAAAACAAAAAwAAAAIAAAACAAAAAwAAAAOAAAADAAAAAAAAAAAAAAMAAAADAAAAHAABAAAAAACcAAMAAQAAABwABACAAAAAHAAQAAMADAB+AP8BeB6eIBQgHiAgICIgJiA6IKwhIvsC//8AAAAgAKEBeB6eIBQgGCAgICIgJiA5IKwhIvsB////4//B/0niJOCv4Kzgq+Cq4KfgleAk368F0QABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQYAAAEAAAAAAAAAAQIAAAACAAAAAAAAAAAAAAAAAAAAAQAAAwQFBgcICQoLDA0ODxAREhMUFRYXGBkaGxwdHh8gISIjJCUmJygpKissLS4vMDEyMzQ1Njc4OTo7PD0+P0BBQkNERUZHSElKS0xNTk9QUVJTVFVWV1hZWltcXV5fYGEAhYaIipKXnaKho6Wkpqiqqausrq2vsLK0s7W3tru6vL3LcWNkaMx3oG9q0XVpAIeZAHIAAGZ2AAAAAABrewCnuYBibQAAAABsfM0AgYSWAAAAw8jJxMW4AMDBANDOz9LTAHjGygCDi4KMiY6PkI2UlQCTm5yaAAAAcAAAAHkAAAAAAAAAAAwADAAMAAwAHgA8AGwAmgDMAQwBHgFCAWYBigGiAa4BugHGAegCGAIuAmAClAK4At4DBgMkA1oDhgOaA64D3APwBBwESARuBIwEsgTWBPAFBgUaBTwFVAVoBYAFrgW8BeAGBAYkBkAGbAaOBroGzAbmBw4HMgdsB5AHuAfKB/IIBAgmCDIIRghmCIoIrgjQCPAJDAkwCVAJYgmCCawJvgniCfgKGAo+CmIKggqkCsAK1gr6CxQLTAtsC4wLsgvGC+wMCgwcDE4MdgysDOAM9A0oDToNZA14DbYNxg3SDfoOBg4kDkIOXg54DooOpg7IDtQO7g7+DxwPWA+MD8YP/BAkEE4QdhCkEMgQ8hEaETwRchGWEbgR4BIEEhwSNBJSEmoSjhK4EuYTEhNCE2oTmBPQFAAUJhRMFGwUkhTCFOIVCBUwFVYVfBWiFc4WABYsFmIWihawFtYXAhcWFygXQBdeF4YXohfKF/IYHhhGGHQYkBi4GNQY8BkMGSwZWBl2GaIZ0hn0GgAaEhokGjYaShpoGoYapBq8GtAa6BsKGywbUBtqG44brAAAAAEAAAAAA4ADgAADAAAxESERA4ADgPyAAAIAAAAAAIADgAADAAcAADE1MxUDETMRgICAgIABAAKA/YAAAAQAAAIAAgADgAADAAcACwAPAAARNTMVMzUzFSURMxEzETMRgICA/wCAgIACAICAgICAAQD/AAEA/wAAAAIAAAAAAoADgAADAB8AAAE1IxUDESM1MzUjNTMRMxEzETMRMxUjFTMVIxEjESMRAYCAgICAgICAgICAgICAgIABgICA/oABAICAgAEA/wABAP8AgICA/wABAP8AAAAAAAUAAAAAAoADgAAHAAsADwATABsAACE1ITUhFSMVEzUzFSU1IRUlNTMVPQEzNTMVIRUBAP8AAgCAgID+AAGA/gCAgIABAICAgIABAICAgICAgICAgICAgIAAAAAABwAAAAACgAOAAAMABwALAA8AEwAXABsAADE1MxUhETMRJREzGQE1MxU1ETMRJREzESU1MxWAAYCA/gCAgID+AIABgICAgAEA/wCAAQD/AAEAgICAAQD/AIABAP8AgICAAAAAAAgAAAAAAoADgAADAAcACwAPABsAHwAjACcAADM1IRUzNTMVJREzEQE1MxUBNSM1IzUzNTMRMxEBNTMVMzUzFSU1MxWAAQCAgP2AgAGAgP8AgICAgID+gICAgP8AgICAgICAAQD/AAEAgID/AICAgID/AP8AAgCAgICAgICAAAAAAgAAAgABAAOAAAMABwAAETUzFTURMxGAgAIAgICAAQD/AAAABQAAAAACAAOAAAMABwALAA8AEwAAITUhFSU1MxUlETMZATUzFT0BIRUBAAEA/oCA/wCAgAEAgICAgICAAYD+gAGAgICAgIAABQAAAAACAAOAAAMABwALAA8AEwAAMTUhFT0BMxU1ETMRATUzFSU1IRUBAICA/wCA/oABAICAgICAgAGA/oABgICAgICAAAAABQAAAQACAAKAAAMABwALAA8AEwAAETUzFSE1MxUlNSEVJTUzFSE1MxWAAQCA/oABAP6AgAEAgAEAgICAgICAgICAgICAAAAAAQAAAIACgAMAAAsAACURITUhETMRIRUhEQEA/wABAIABAP8AgAEAgAEA/wCA/wAAAQAA/4AAgAEAAAMAABURMxGAgAGA/oAAAQAAAYACgAIAAAMAABE1IRUCgAGAgIAAAQAAAAAAgAEAAAMAADERMxGAAQD/AAAABQAAAAACgAOAAAMABwALAA8AEwAAMTUzFTURMxkBNTMVNREzGQE1MxWAgICAgICAgAEA/wABAICAgAEA/wABAICAAAAFAAAAAAKAA4AAAwAHAA8AFwAbAAAzNSEVATUzFQERMxEzFSMVIREjNTM1MxEBNSEVgAGA/wCA/oCAgIABgICAgP4AAYCAgAGAgID/AAKA/oCAgAGAgID9gAKAgIAAAAABAAAAAAKAA4AACwAAMTUhESM1MzUzESEVAQCAgIABAIACAICA/QCAAAAAAAYAAAAAAoADgAAHAAsADwATABcAGwAAMREzFSE1MxEBNTMVPQEhFQE1MxUFETMRATUhFYABgID+AIABAP4AgAGAgP4AAYABAICA/wABAICAgICAAQCAgIABAP8AAQCAgAAAAAAHAAAAAAKAA4AAAwAHAAsADwATABcAGwAAMzUhFSU1MxUhETMRATUhFQE1MxUFETMRATUhFYABgP4AgAGAgP6AAQD+AIABgID+AAGAgICAgIABAP8AAQCAgAEAgICAAQD/AAEAgIAAAAMAAAAAAoADgAADAAcAEwAAEzUzFT0BMxUTESERMxUhESM1IRGAgICA/gCAAYCAAQACAICAgICA/YABAAEAgAGAgPyAAAAAAAQAAAAAAoADgAADAAcACwATAAAzNSEVJTUzFSERMxEBESEVIRUhFYABgP4AgAGAgP2AAoD+AAGAgICAgIABgP6AAYABgICAgAAAAAAFAAAAAAKAA4AAAwAHAA8AEwAXAAAzNSEVNREzESERMxUhFSEZATUzFT0BIRWAAYCA/YCAAYD+gIABAICAgAEA/wACAICA/wACAICAgICAAAMAAAAAAoADgAADAAcADwAAIREzGQE1MxU1ESEVIxEhEQEAgID+gIACgAGA/oABgICAgAEAgAEA/oAAAAcAAAAAAoADgAADAAcACwAPABMAFwAbAAAzNSEVJREzESERMxEBNSEVJREzESERMxEBNSEVgAGA/gCAAYCA/gABgP4AgAGAgP4AAYCAgIABAP8AAQD/AAEAgICAAQD/AAEA/wABAICAAAAAAAUAAAAAAoADgAADAAcACwATABcAADM1IRU9ATMVAREzEQE1ITUhETMRATUhFYABAID+AIABgP6AAYCA/gABgICAgICAAYABAP8A/wCAgAEA/gACAICAAAACAAAAAACAAwAAAwAHAAAxETMRAxEzEYCAgAEA/wACAAEA/wAAAAAAAgAA/4AAgAMAAAMABwAAFREzEQMRMxGAgICAAYD+gAKAAQD/AAAAAAcAAAAAAgADgAADAAcACwAPABMAFwAbAAAhNTMVJTUzFSU1MxUlNTMVPQEzFT0BMxU9ATMVAYCA/wCA/wCA/wCAgICAgICAgICAgICAgICAgICAgICAgIAAAAAAAgAAAIACgAKAAAMABwAAPQEhFQE1IRUCgP2AAoCAgIABgICAAAAAAAcAAAAAAgADgAADAAcACwAPABMAFwAbAAAxNTMVPQEzFT0BMxU9ATMVJTUzFSU1MxUlNTMVgICAgP8AgP8AgP8AgICAgICAgICAgICAgICAgICAgICAAAAGAAAAAAKAA4AAAwAHAAsADwATABcAACE1MxUDNTMVPQEzFQE1MxUFETMRATUhFQEAgICAgP4AgAGAgP4AAYCAgAEAgICAgIABAICAgAEA/wABAICAAAAABAAAAAADAAOAAAMABwAPABMAADM1IRUlETMRNxEhETMRMxEBNSEVgAIA/YCAgAEAgID9gAIAgICAAoD9gIABgP8AAYD+AAIAgIAAAAIAAAAAAoADgAALAA8AADERMxEhETMRIxEhGQE1IRWAAYCAgP6AAYADAP8AAQD9AAGA/oADAICAAAAAAAMAAAAAAoADgAADAAcAEwAAJREzEQM1MxUBESEVIRUhFSERIRUCAICAgP2AAgD+gAGA/oABgIABgP6AAgCAgP2AA4CAgID+gIAAAAAFAAAAAAKAA4AAAwAHAAsADwATAAAzNSEVPQEzFSERMxEBNTMVJTUhFYABgID9gIABgID+AAGAgICAgIACgP2AAgCAgICAgAACAAAAAAKAA4AAAwALAAAlETMRBREhFSERIRUCAID9gAIA/oABgIACgP2AgAOAgP2AgAAAAQAAAAACgAOAAAsAADERIRUhFSEVIREhFQKA/gABAP8AAgADgICAgP6AgAABAAAAAAKAA4AACQAAMREhFSEVIRUhEQKA/gABAP8AA4CAgID+AAAABAAAAAACgAOAAAMACQANABEAADM1IRU1ESE1IREhETMZATUhFYABgP8AAYD9gIACAICAgAGAgP4AAoD9gAKAgIAAAAABAAAAAAKAA4AACwAAMREzESERMxEjESERgAGAgID+gAOA/wABAPyAAgD+AAAAAAABAAAAAAGAA4AACwAAMTUzESM1IRUjETMVgIABgICAgAKAgID9gIAAAwAAAAACgAOAAAMABwALAAAzNSEVJTUzFSERMxGAAYD+AIABgICAgICAgAMA/QAABQAAAAACgAOAAAMABwALABMAFwAAIREzEQE1MxUDNTMVAREzESEVIREBNTMVAgCA/wCAgID+AIABAP8AAYCAAYD+gAGAgIABAICA/YADgP8AgP4AAwCAgAAAAAABAAAAAAKAA4AABQAAMREzESEVgAIAA4D9AIAAAwAAAAACgAOAAAMACwATAAABNTMVAREzFTMVIxEhESM1MzUzEQEAgP6AgICAAYCAgIACAICA/gADgICA/YACgICA/IAAAAAAAwAAAAACgAOAAAMACwATAAABNTMVAREzFTMVIxEhESM1MxEzEQEAgP6AgICAAYCAgIACAICA/gADgICA/YABgIABgPyAAAAABAAAAAACgAOAAAMABwALAA8AADM1IRUlETMRIREzEQE1IRWAAYD+AIABgID+AAGAgICAAoD9gAKA/YACgICAAAIAAAAAAoADgAADAA0AAAE1MxUBESEVIRUhFSERAgCA/YACAP6AAYD+gAKAgID9gAOAgICA/gAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVMzUzFSU1MxUhETMRJREzEQE1IRWAAQCAgP8AgP4AgAGAgP4AAYCAgICAgICAAoD9gIACAP4AAgCAgAAAAAMAAAAAAoADgAADAAcAEQAAIREzEQM1MxUBESEVIRUhFSERAgCAgID9gAIA/oABgP6AAgD+AAKAgID9gAOAgICA/gAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVJTUzFSERMxEBNSEVJTUzFT0BIRWAAYD+AIABgID+AAGA/gCAAgCAgICAgAGA/oABgICAgICAgICAAAAAAAEAAAAAAoADgAAHAAAhESE1IRUhEQEA/wACgP8AAwCAgP0AAAMAAAAAAoADgAADAAcACwAAMzUhFSURMxEhETMRgAGA/gCAAYCAgICAAwD9AAMA/QAAAAAFAAAAAAKAA4AAAwAHAAsADwATAAAhNTMVJREzETMRMxEBETMRIREzEQEAgP8AgICA/gCAAYCAgICAAQD/AAEA/wABAAIA/gACAP4AAAAAAAMAAAAAAoADgAADAAsAEwAAATUzFQERMxEzFSMVITUjNTMRMxEBAID+gICAgAGAgICAAQCAgP8AA4D9gICAgIACgPyAAAAAAAkAAAAAAoADgAADAAcACwAPABMAFwAbAB8AIwAAMREzESERMxEBNTMVMzUzFSU1MxUlNTMVMzUzFSU1MxUhNTMVgAGAgP4AgICA/wCA/wCAgID+AIABgIABgP6AAYD+gAGAgICAgICAgICAgICAgICAgIAABQAAAAACgAOAAAMABwALAA8AEwAAIREzEQE1MxUzNTMVJTUzFSE1MxUBAID/AICAgP4AgAGAgAKA/YACgICAgICAgICAgAAABQAAAAACgAOAAAUACQANABEAFwAAMREzFSEVATUzFT0BMxU9ATMVPQEhNSERgAH//gGAgID+AAKAAQCAgAEAgICAgICAgICAgID/AAAAAAABAAAAAAGAA4AABwAAMREhFSERIRUBgP8AAQADgID9gIAAAAAFAAAAAAKAA4AAAwAHAAsADwATAAAhNTMVJREzEQE1MxUlETMRATUzFQIAgP8AgP8AgP8AgP8AgICAgAEA/wABAICAgAEA/wABAICAAAAAAAEAAAAAAYADgAAHAAAxNSERITUhEQEA/wABgIACgID8gAAAAAUAAAIAAoADgAADAAcACwAPABMAABE1MxUhNTMVJTUzFTM1MxUlNTMVgAGAgP4AgICA/wCAAgCAgICAgICAgICAgIAAAQAAAAACgACAAAMAADE1IRUCgICAAAAAAgAAAgABAAOAAAMABwAAEzUzFSURMxGAgP8AgAIAgICAAQD/AAAAAAMAAAAAAoACgAADAA0AEQAAPQEzHQE1ITUhNSE1MxEBNSEVgAGA/oABgID+AAGAgICAgICAgID+AAIAgIAAAAADAAAAAAKAA4AAAwAHABEAACURMxEBNSEVAREzETMVIxEhFQIAgP6AAQD+AICAgAGAgAGA/oABgICA/gADgP6AgP8AgAAAAAAFAAAAAAKAAoAAAwAHAAsADwATAAAzNSEVPQEzFSERMxEBNTMVJTUhFYABgID9gIABgID+AAGAgICAgIABgP6AAQCAgICAgAADAAAAAAKAA4AAAwAHABEAADURMxkBNSEVATUhESM1MxEzEYABAP8AAYCAgICAAYD+gAGAgID+AIABAIABgPyAAAAAAAMAAAAAAoACgAADAA0AEQAAMzUhFSURMxUhNTMRIRURNSEVgAIA/YCAAYCA/gABgICAgAGAgID/AIABgICAAAACAAAAAAIAA4AACwAPAAAzESM1MzUzFSEVIRkBNSEVgICAgAEA/wABAAIAgICAgP4AAwCAgAAAAAMAAP+AAoACgAADAAcAEQAAFTUhFQERMxEBNSE1IREhNSERAgD+AIABgP6AAYD+gAIAgICAAYABAP8A/wCAgAEAgP2AAAAAAAMAAAAAAoADgAADAAcADwAAIREzEQE1IRUBETMRMxUjEQIAgP6AAQD+AICAgAIA/gACAICA/gADgP6AgP6AAAACAAAAAACAA4AAAwAHAAAxETMRAzUzFYCAgAKA/YADAICAAAAEAAD/gAKAA4AAAwAHAAsADwAAFzUhFSURMxEhETMRAzUzFYABgP4AgAGAgICAgICAgAEA/wACgP2AAwCAgAAABQAAAAACAAOAAAMABwALAA8AFwAAITUzFSU1MxUDNTMVPQEzFQERMxEzFSMRAYCA/wCAgICA/gCAgICAgICAgAEAgICAgID+AAOA/gCA/wAAAAAAAgAAAAABAAOAAAMABwAAMzUzFSURMxGAgP8AgICAgAMA/QAABAAAAAACgAKAAAMABwANABEAAAERMxETETMRIREhFSMRATUzFQEAgICA/YABAIABAIABAAEA/wD/AAIA/gACgID+AAIAgIAAAgAAAAACgAKAAAMACQAAIREzESERIRUhEQIAgP2AAgD+gAIA/gACgID+AAAEAAAAAAKAAoAAAwAHAAsADwAAMzUhFSURMxEhETMRATUhFYABgP4AgAGAgP4AAYCAgIABgP6AAYD+gAGAgIAAAwAA/4ACgAKAAAMADwATAAABETMRAREzFTMVIxUhFSEREzUhFQIAgP2AgICAAYD+gIABAAEAAQD/AP6AAwCAgICA/wACgICAAAAAAAMAAP+AAoACgAADAAcAEwAAGQEzGQE1IRUTESE1ITUjNTM1MxGAAQCA/oABgICAgAEAAQD/AAEAgID9gAEAgICAgP0AAAAAAAMAAAAAAoACgAADAAsADwAAATUzFQERMxUzFSMREzUhFQIAgP2AgICAgAEAAYCAgP6AAoCAgP6AAgCAgAAAAAAFAAAAAAKAAoAAAwAHAAsADwATAAAxNSEVPQEzFSU1IRUlNTMVPQEhFQIAgP4AAYD+AIACAICAgICAgICAgICAgICAAAIAAAAAAYADgAADAA8AACE1MxUlESM1MxEzETMVIxEBAID/AICAgICAgICAAYCAAQD/AID+gAAAAgAAAAACgAKAAAMACQAANREzERU1IREzEYABgICAAgD+AICAAgD9gAAAAAAFAAAAAAKAAoAAAwAHAAsADwATAAAhNTMVJTUzFTM1MxUlETMRIREzEQEAgP8AgICA/gCAAYCAgICAgICAgIABgP6AAYD+gAACAAAAAAKAAoAAAwANAAA1ETMRFTUzETMRMxEzEYCAgICAgAIA/gCAgAEA/wACAP2AAAAACQAAAAACgAKAAAMABwALAA8AEwAXABsAHwAjAAAxNTMVITUzFSU1MxUzNTMVJTUzFSU1MxUzNTMVJTUzFSE1MxWAAYCA/gCAgID/AID/AICAgP4AgAGAgICAgICAgICAgICAgICAgICAgICAgIAAAAMAAP+AAoACgAADAAcADwAAFTUhFQERMxEBNSE1IREzEQIA/gCAAYD+gAGAgICAgAGAAYD+gP8AgIABgP2AAAADAAAAAAKAAoAABwALABMAADE1MzUzFSEVATUzFT0BITUhFSMVgIABgP6AgP6AAoCAgICAgAEAgICAgICAgAAABQAAAAACAAOAAAMABwALAA8AEwAAITUhFSURMxEBNTMVNREzGQE1IRUBAAEA/oCA/wCAgAEAgICAAQD/AAEAgICAAQD/AAEAgIAAAAIAAAAAAIADgAADAAcAADERMxEDETMRgICAAYD+gAIAAYD+gAAAAAAFAAAAAAIAA4AAAwAHAAsADwATAAAxNSEVNREzGQE1MxUlETMRATUhFQEAgID/AID+gAEAgICAAQD/AAEAgICAAQD/AAEAgIAAAAAABAAAAoADAAOAAAMABwALAA8AABE1MxUhNSEVJTUhFSE1MxWAAQABAP4AAQABAIACgICAgICAgICAgAAAAgAAAAAAgAMAAAMABwAAMREzEQM1MxWAgIACAP4AAoCAgAAABAAAAAACgAOAAAMABwALAB8AAAE1MxUhETMRATUzFQE1IzUzESM1MzUzFTMVIxEzFSMVAgCA/YCAAYCA/oCAgICAgICAgIABAICAAYD+gAEAgID+AICAAYCAgICA/oCAgAAAAAMAAAAAAoADgAAPABMAFwAAMTUzESM1MxEzESEVIREhFQM1MxUlNSEVgICAgAEA/wABgICA/oABAIABAIABAP8AgP8AgAKAgICAgIAAAAAACAAAAIACAAMAAAMABwALAA8AEwAXABsAHwAAPQEzFSE1MxUlNSEVJTUzFSE1MxUlNSEVJTUzFSE1MxWAAQCA/oABAP6AgAEAgP6AAQD+gIABAICAgICAgICAgICAgICAgICAgICAgIAAAAAABQAAAAACgAOAABMAFwAbAB8AIwAAITUjNTM1IzUzNTMVMxUjFTMVIxUBNTMVMzUzFSU1MxUhNTMVAQCAgICAgICAgID/AICAgP4AgAGAgICAgICAgICAgIACgICAgICAgICAgAAAAAACAAAAAACAA4AAAwAHAAAxETMRAxEzEYCAgAGA/oACAAGA/oAAAAAACAAAAAACAAOAAAMABwALAA8AEwAXABsAHwAAMTUhFT0BMxUlNSEVJTUzFSE1MxUlNSEVJTUzFT0BIRUBgID+gAEA/oCAAQCA/oABAP6AgAGAgICAgICAgICAgICAgICAgICAgICAgAACAAADAAKAA4AAAwAHAAARNSEVMzUhFQEAgAEAAwCAgICAAAADAAAAAAMAAoAADQARABsAADM1IxEzETMVMzUzFTMVNREzESURIzUhFSMVIxWAgICAgICAgP4AgAIAgICAAYD/AICAgICAAYD+gIABAICAgIAAAAABAAACAAGAA4AACQAAETUzNSM1IRUzEYCAAQCAAgCAgICA/wAAAAAACgAAAAACgAKAAAMABwALAA8AEwAXABsAHwAjACcAACE1MxUzNTMVJTUzFTM1MxUlNTMVMzUzFSU1MxUzNTMVJTUzFTM1MxUBAICAgP4AgICA/gCAgID/AICAgP8AgICAgICAgICAgICAgICAgICAgICAgICAgICAAAAAAAEAAAAAAoABgAAFAAAhESE1IRECAP4AAoABAID+gAAAAQAAAgACgAKAAAMAABE1IRUCgAIAgIAAAwAAAQADAAOAAAMABwAZAAABNSMVIREzERU1MxEzNSE1IRUjFTM1MxEjFQIAgP6AgICA/wACAICAgIABgICAAYD+gICAAQCAgICAgP6AgAABAAADAAKAA4AAAwAAETUhFQKAAwCAgAAEAAACAAGAA4AAAwAHAAsADwAAEzUzFSU1MxUzNTMVJTUzFYCA/wCAgID/AIACAICAgICAgICAgIAAAAACAAAAAAMAA4AAAwAPAAAxNSEVAREhNSERIREhFSERAwD+AP8AAQABAAEA/wCAgAEAAQCAAQD/AID/AAABAAABAAIAA4AAEQAAGQEzNTM1ITUhFTMVIxUjFSEVgID/AAGAgICAAQABAAEAgICAgICAgIAAAAEAAAEAAgADgAAPAAARNSE1IzUzNSE1IRUzESMVAQCAgP8AAYCAgAEAgICAgICA/oCAAAACAAACAAEAA4AAAwAHAAARNTMVNREzEYCAAgCAgIABAP8AAAABAAAAgAOAA4AADwAAPQEzESERIREhESMVIRUjFYABAAEAAQCA/oCAgIACgP6AAYD+gICAgAAAAAIAAAAABAADgAADABEAAAERIxETESE1IxEzNSERIREjEQGAgID/AICAA4D/AIACAAEA/wD+AAGAgAEAgPyAAwD9AAAAAQAAAQABAAGAAAMAABE1IRUBAAEAgIAAAwAAAAABgAIAAAMABwANAAAxNSEVPQEzFSU1MzUzEQEAgP6AgICAgICAgICAgP8AAAAAAAEAAAIAAQADgAAFAAATESM1IRGAgAEAAgABAID+gAAABAAAAgABgAOAAAMABwALAA8AABM1MxUlNTMVMzUzFSU1MxWAgP8AgICA/wCAAgCAgICAgICAgICAAAAACgAAAAACgAKAAAMABwALAA8AEwAXABsAHwAjACcAADE1MxUzNTMVJTUzFTM1MxUlNTMVMzUzFSU1MxUzNTMVJTUzFTM1MxWAgID/AICAgP8AgICA/gCAgID+AICAgICAgICAgICAgICAgICAgICAgICAgICAgAAABwAAAAACgAOAAAMABwANABEAFQAZAB0AADE1MxU1ETMRBTUjESERATUzFTURMxElETMRJTUzFYCAAQCAAQD+gICA/gCAAYCAgICAAQD/AICAAQD+gAGAgICAAQD/AIABAP8AgICAAAAIAAAAAAKAA4AAAwAJAA0AEQAVABkAHQAhAAAxNTMVIREzFTMVJREzESU1MxUlNTMVNREzESURMxElNTMVgAEAgID+AIABAID+gICA/gCAAYCAgIABAICAgAEA/wCAgICAgICAAQD/AIABAP8AgICAAAAAAAUAAAAAAoADgAADAAkADQAbAB8AADE1MxUhNSMRIREBETMRAREjNTM1IxEhETMVIxEBNTMVgAGAgAEA/wCA/oCAgIABAICAAQCAgICAAQD+gAIAAQD/AP6AAQCAgAEA/oCA/wACgICAAAAAAAYAAAAAAoADgAADAAcACwAPABMAFwAAMzUhFT0BMxUhETMZATUzFT0BMxUDNTMVgAGAgP2AgICAgICAgICAgAEA/wABAICAgICAAQCAgAAABAAAAAACgAUAAAsADwATABcAADERMxEhETMRIxEhGQE1IRUBNTMVJTUzFYABgICA/oABgP8AgP8AgAMA/wABAP0AAYD+gAMAgIABAICAgICAAAAABAAAAAACgAUAAAsADwATABcAADERMxEhETMRIxEhGQE1IRUBNTMVPQEzFYABgICA/oABgP8AgIADAP8AAQD9AAGA/oADAICAAQCAgICAgAAFAAAAAAKABQAACwAPABMAFwAbAAAxETMRIREzESMRIRkBNSEVATUzFTM1MxUlNTMVgAGAgID+gAGA/oCAgID/AIADAP8AAQD9AAGA/oADAICAAQCAgICAgICAAAMAAAAAAoAEgAALAA8AEwAAMREzESERMxEjESEZATUhFQE1IRWAAYCAgP6AAYD+gAGAAwD/AAEA/QABgP6AAwCAgAEAgIAAAAQAAAAAAoAEgAALAA8AEwAXAAAxETMRIREzESMRIRkBNSEVATUhFTM1IRWAAYCAgP6AAYD+AAEAgAEAAwD/AAEA/QABgP6AAwCAgAEAgICAgAAAAAMAAAAAAoAEgAALABMAFwAAMREzESERMxEjESEZAjMVMzUzEQE1MxWAAYCAgP6AgICA/wCAAwD/AAEA/QABgP6AAwABAICA/wABAICAAAAAAQAAAAACgAOAABUAADERMxUzNSM1IRUhFTMVIxEhFSERIxGAgIACAP8AgIABAP6AgAMAgICAgICA/oCAAgD+AAAAAAAHAAD/AAKAA4AABwALAA8AEwAXABsAHwAAATUjNSEVMxUDNTMVJTUhFT0BMxUhETMRATUzFSU1IRUBgIABAICAgP4AAYCA/YCAAYCA/gABgP8AgICAgAEAgICAgICAgIACAP4AAYCAgICAgAADAAAAAAKABQAACwAPABMAADERIRUhFSEVIREhFQE1MxUlNTMVAoD+AAEA/wACAP6AgP8AgAOAgICA/oCABACAgICAgAAAAAADAAAAAAKABQAACwAPABMAADERIRUhFSEVIREhFQE1MxU9ATMVAoD+AAEA/wACAP6AgIADgICAgP6AgAQAgICAgIAAAAQAAAAAAoAFAAALAA8AEwAXAAAxESEVIRUhFSERIRUBNTMVMzUzFSU1MxUCgP4AAQD/AAIA/gCAgID/AIADgICAgP6AgAQAgICAgICAgAAAAwAAAAACgASAAAsADwATAAAxESEVIRUhFSERIRUBNSEVMzUhFQKA/gABAP8AAgD9gAEAgAEAA4CAgID+gIAEAICAgIAAAAAAAwAAAAABAAQAAAMABwALAAAzETMRAzUzFSU1MxWAgICA/wCAAoD9gAMAgICAgIAAAwCAAAABgAQAAAMABwALAAAzETMRAzUzFT0BMxWAgICAgAKA/YADAICAgICAAAAABAAAAAABgAQAAAMABwALAA8AADMRMxEBNTMVMzUzFSU1MxWAgP8AgICA/wCAAoD9gAMAgICAgICAgAAAAwAAAAABgAOAAAMABwALAAAzETMRATUzFTM1MxWAgP8AgICAAoD9gAMAgICAgAAAAv+AAAACgAOAAAMAEwAAJREzEQURIzUzESEVIREhFSERIRUCAID9gICAAgD+gAEA/wABgIACgP2AgAGAgAGAgP8AgP8AgAAABAAAAAACgASAAAMACwATABcAAAE1MxUBETMVMxUjESERIzUzETMRATUhFQEAgP6AgICAAYCAgID+AAGAAgCAgP4AA4CAgP2AAYCAAYD8gAQAgIAABgAAAAACgAUAAAMABwALAA8AEwAXAAAzNSEVJREzESERMxEBNSEVATUzFSU1MxWAAYD+AIABgID+AAGA/wCA/wCAgICAAoD9gAKA/YACgICAAQCAgICAgAAAAAAGAAAAAAKABQAAAwAHAAsADwATABcAADM1IRUlETMRIREzEQE1IRUBNTMVPQEzFYABgP4AgAGAgP4AAYD/AICAgICAAoD9gAKA/YACgICAAQCAgICAgAAABgAAAAACgAUAAAMABwALAA8AFQAZAAAzNSEVJREzESERMxEBNTMVAzUhETMRATUzFYABgP4AgAGAgP4AgIABAID/AICAgIACgP2AAoD9gAOAgID/AIABAP6AAYCAgAAABQAAAAACgASAAAMABwALAA8AEwAAMzUhFSURMxEhETMRATUhFQE1IRWAAYD+AIABgID+AAGA/oABgICAgAKA/YACgP2AAoCAgAEAgIAAAAAGAAAAAAKABIAAAwAHAAsADwATABcAADM1IRUlETMRIREzEQE1IRUBNSEVMzUhFYABgP4AgAGAgP4AAYD+AAEAgAEAgICAAoD9gAKA/YACgICAAQCAgICAAAAAAAkAAACAAoADAAADAAcACwAPABMAFwAbAB8AIwAAPQEzFSE1MxUlNTMVMzUzFSU1MxUlNTMVMzUzFSU1MxUhNTMVgAGAgP4AgICA/wCA/wCAgID+AIABgICAgICAgICAgICAgICAgICAgICAgICAgAAFAAAAAAKAA4AAAwAHAA8AFwAbAAAzNSEVATUzFQERMxEzFSMVIREjNTM1MxEBNSEVgAGA/wCA/oCAgIABgICAgP4AAYCAgAGAgID/AAKA/oCAgAGAgID9gAKAgIAAAAAFAAAAAAKABIAAAwAHAAsADwATAAAzNSEVJREzESERMxEBNTMVJTUzFYABgP4AgAGAgP6AgP8AgICAgAMA/QADAP0AAwCAgICAgAAABQAAAAACgASAAAMABwALAA8AEwAAMzUhFSURMxEhETMRATUzFT0BMxWAAYD+AIABgID+gICAgICAAwD9AAMA/QADAICAgICAAAAAAAQAAAAAAoAEgAADAAcACwAPAAAzNSEVJREzESERMxEBNSEVgAGA/gCAAYCA/gABgICAgAMA/QADAP0AA4CAgAAFAAAAAAKABIAAAwAHAAsADwATAAAzNSEVJREzESERMxEBNSEVMzUhFYABgP4AgAGAgP2AAQCAAQCAgIADAP0AAwD9AAOAgICAgAAABwAAAAACgASAAAMABwALAA8AEwAXABsAACERMxEBNTMVMzUzFSU1MxUhNTMVJTUzFT0BMxUBAID/AICAgP4AgAGAgP6AgIACgP2AAoCAgICAgICAgICAgICAgIAAAAAAAgAAAAACAAOAAAMADwAAAREzEQERMxUhFSERIRUhFQGAgP4AgAEA/wABAP8AAQABgP6A/wADgICA/oCAgAAAAAQAAAAAAoADgAAFAAkADQATAAAhNSERMxEBNTMVNREzEQERIRUhEQEAAQCA/wCAgP2AAgD+gIABAP6AAYCAgIABAP8A/gADgID9AAAFAAAAAAKAA4AAAwAHAA0AEQAVAAAzNSEVJTUzFT0BITUzEQE1IRUBNSEVgAIA/YCAAYCA/gABgP4AAQCAgICAgICAgP8AAQCAgAEAgIAAAAQAAAAAAoADgAADAA0AEQAVAAA9ATMdATUhNSE1ITUzEQE1IRUDNSEVgAGA/oABgID+AAGAgAEAgICAgICAgID+AAIAgIABAICAAAAEAAAAAAKAA4AAAwANABEAFQAAPQEzHQE1ITUhNSE1MxEBNSEVATUzFYABgP6AAYCA/gABgP8AgICAgICAgICA/gACAICAAQCAgAAABAAAAAACgAOAAAMADQARABUAAD0BMx0BNSE1ITUhNTMRATUhFQE1IRWAAYD+gAGAgP4AAYD+gAGAgICAgICAgID+AAIAgIABAICAAAUAAAAAAoADgAADAA0AEQAVABkAAD0BMx0BNSE1ITUhNTMRATUhFQE1MxUzNTMVgAGA/oABgID+AAGA/oCAgICAgICAgICAgP4AAgCAgAEAgICAgAAAAAAGAAAAAAKAA4AAAwANABEAFQAZAB0AAD0BMx0BNSE1ITUhNTMRATUhFSU1MxUhNTMVJTUhFYABgP6AAYCA/gABgP4AgAGAgP4AAYCAgICAgICAgP4AAgCAgICAgICAgICAAAAABAAAAAACgAKAAAMAFQAZAB0AAD0BMx0BNTM1IzUzNTMVMzUzESEVIRUBNTMVMzUzFYCAgICAgID/AAEA/gCAgICAgICAgICAgICA/wCAgAIAgICAgAAAAAgAAP8AAoADAAADAAcACwAPABMAFwAbAB8AABE1IRU9ASEVPQEzFSU1IRU9ATMVIREzEQE1MxUlNSEVAQABAID+AAGAgP2AgAGAgP4AAYD/AICAgICAgICAgICAgICAAYD+gAEAgICAgIAAAAQAAAAAAoADgAADAA0AEQAVAAAzNSEVJREzFSE1MxEhFRE1IRUBNSEVgAIA/YCAAYCA/gABgP4AAQCAgIABgICA/wCAAYCAgAEAgIAAAAAABAAAAAACgAOAAAMADQARABUAADM1IRUlETMVITUzESEVETUhFQM1IRWAAgD9gIABgID+AAGAgAEAgICAAYCAgP8AgAGAgIABAICAAAQAAAAAAoADgAADAA0AEQAVAAAzNSEVJREzFSE1MxEhFRE1IRUBNTMVgAGA/gCAAYCA/gABgP8AgICAgAGAgID/AIABgICAAQCAgAAFAAAAAAKAA4AAAwANABEAFQAZAAAzNSEVJREzFSE1MxEhFRE1IRUBNSEVMzUhFYABgP4AgAGAgP4AAYD+AAEAgAEAgICAAYCAgP8AgAGAgIABAICAgIAAAgAAAAABAAQAAAMABwAAMxEzEQERMxGAgP8AgAKA/YADAAEA/wAAAAIAAAAAAQAEAAADAAcAADERMxkCMxGAgAKA/YADAAEA/wAAAAMAAAAAAIAEgAADAAcACwAAMREzEQM1MxUDNTMVgICAgIACgP2AAwCAgAEAgIAAAAQAAAAAAYAEgAADAAcACwAPAAAzETMRAzUzFQE1MxUzNTMVgICAgP8AgICAAoD9gAMAgIABAICAgIAAAAMAAAAAAoAEAAADAAcAFwAANREzGQE1MxUDNSERITUhNSE1MzUzFTMRgICAAYD+gAGA/wCAgICAAYD+gAMAgID8gIABgICAgICA/IAAAAAAAwAAAAACgAOAAAMACQANAAAhETMRIREhFSEZATUhFQIAgP2AAgD+gAGAAgD+AAKAgP4AAwCAgAAFAAAAAAKAA4AAAwAHAAsADwATAAAzNSEVJREzESERMxEBNSEVATUhFYABgP4AgAGAgP4AAYD+AAEAgICAAYD+gAGA/oABgICAAQCAgAAAAAUAAAAAAoADgAADAAcACwAPABMAADM1IRUlETMRIREzEQE1IRUDNSEVgAGA/gCAAYCA/gABgIABAICAgAGA/oABgP6AAYCAgAEAgIAAAAAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVJREzESERMxEBNSEVPQEzFSU1IRWAAYD+AIABgID+AAGAgP4AAYCAgIABgP6AAYD+gAGAgICAgICAgIAAAAUAAAAAAoADgAADAAcACwAPABMAADM1IRUlETMRIREzEQE1IRUBNSEVgAGA/gCAAYCA/gABgP6AAYCAgIABgP6AAYD+gAGAgIABAICAAAAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVJREzESERMxEBNSEVATUhFTM1IRWAAYD+AIABgID+AAGA/gABAIABAICAgAGA/oABgP6AAYCAgAEAgICAgAAAAAADAAAAAAMAA4AAAwAHAAsAACERIREBNSEVAREhEQEAAQD+AAMA/gABAAEA/wABgICAAQABAP8AAAMAAAAAAoACgAADAA0AFwAAATUzFQE1IxEzETMVIRU1ESM1ITUhFTMRAQCA/wCAgIABAID/AAGAgAEAgID/AIABgP8AgICAAQCAgID+gAAAAwAAAAACgAOAAAMACQANAAA1ETMRFTUhETMRATUhFYABgID9gAEAgAIA/gCAgAIA/YADAICAAAADAAAAAAKAA4AAAwAJAA0AADURMxEVNSERMxEBNSEVgAGAgP8AAQCAAgD+AICAAgD9gAMAgIAAAAMAAAAAAoADgAADAAkADQAANREzERU1IREzEQE1MxWAAYCA/oCAgAIA/gCAgAIA/YADAICAAAAABAAAAAACgAOAAAMACQANABEAADURMxEVNSERMxEBNTMVMzUzFYABgID+AICAgIACAP4AgIACAP2AAwCAgICAAAUAAP+AAoADgAADAAcADwATABcAABU1IRUBETMRATUhNSERMxEBNTMVPQEzFQIA/gCAAYD+gAGAgP6AgICAgIABgAGA/oD/AICAAYD9gAKAgICAgIAAAAACAAD/gAGAAwAAAwAPAAABNTMVAREzETMVIxUzFSMRAQCA/oCAgICAgAEAgID+gAOA/wCAgID/AAAAAAAFAAD/gAKAA4AAAwAHAA8AEwAXAAAVNSEVAREzEQE1ITUhETMRATUzFTM1MxUCAP4AgAGA/oABgID+AICAgICAgAGAAYD+gP8AgIABgP2AAwCAgICAAAAABwAAAAACgASAAAMABwALAA8AEwAXABsAACERMxEBNTMVMzUzFSU1MxUhNTMVATUhFTM1IRUBAID/AICAgP4AgAGAgP2AAQCAAQACgP2AAoCAgICAgICAgIABAICAgIAAAwAAAAACgAOAAAMACwARAAAhNSEVNREjNTMRMxEFESEVIREBAAEAgICA/YACAP6AgICAAQCAAQD9gIADgID9AAAAAAABAAABgAKAAgAAAwAAETUhFQKAAYCAgAACAAACAAEAA4AAAwAHAAARNTMVNREzEYCAAgCAgIABAP8AAAACAAACAAEAA4AAAwAHAAARNTMVNREzEYCAAgCAgIABAP8AAAACAAAAAAEAAYAAAwAHAAAxNTMVNREzEYCAgICAAQD/AAAAAAACAAACAAEAA4AAAwAHAAATNTMVJREzEYCA/wCAAgCAgIABAP8AAAAABAAAAgACAAOAAAMABwALAA8AABE1MxUzNTMVJREzETMRMxGAgID/AICAgAIAgICAgIABAP8AAQD/AAAABAAAAgACAAOAAAMABwALAA8AABE1MxUzNTMVJREzETMRMxGAgID/AICAgAIAgICAgIABAP8AAQD/AAAABAAAAAACAAGAAAMABwALAA8AADE1MxUzNTMVJREzETMRMxGAgID/AICAgICAgICAAQD/AAEA/wAAAAAAAQAAAAACgAOAAAsAACERITUhETMRIRUhEQEA/wABAIABAP8AAgCAAQD/AID+AAAAAQAAAQABgAKAAAsAABM1IzUzNTMVMxUjFYCAgICAgAEAgICAgICAAAMAAAAAAoABAAADAAcACwAAMREzETMRMxEzETMRgICAgIABAP8AAQD/AAEA/wAAAAUAAACAAYADAAADAAcACwAPABMAACU1MxUlNTMVJTUzFT0BMxU9ATMVAQCA/wCA/wCAgICAgICAgICAgICAgICAgIAABQAAAIABgAMAAAMABwALAA8AEwAAPQEzFT0BMxU9ATMVJTUzFSU1MxWAgID/AID/AICAgICAgICAgICAgICAgIAAAAABAAAAAAKAA4AAFwAAITUjNSMRMzUzNSEVIRUjFSEVIRUzFSEVAQCAgICAAYD/AIABgP6AgAEAgIABgICAgICAgICAgAAAAAABAAACAAMAA4AADwAAExEjNSEVMzUzFTMRITUjFYCAAYCAgID/AIACAAEAgICAgP8AgIAAAwAAAAACgAOAAA0AEQAVAAAzESM1MzUzFSERIxEhGQE1MxUzNTMVgICAgAGAgP8AgICAAgCAgID9gAIA/gADAICAgIAAAAAAAgAAAAACgAOAAAsAEQAAMxEjNTM1MxUzFSMRIREhNSERgICAgICAAQD/AAGAAgCAgICA/gADAID8gAAAAAAeAW4AAQAAAAAAAAAWAC4AAQAAAAAAAQALAF0AAQAAAAAAAgAHAHkAAQAAAAAAAwALAJkAAQAAAAAABAATAM0AAQAAAAAABQALAPkAAQAAAAAABgALAR0AAQAAAAAACAAMAUMAAQAAAAAACQAMAWoAAQAAAAAACgABAXsAAQAAAAAACwAaAbMAAQAAAAAADAAaAgQAAQAAAAAADQAoAnEAAQAAAAAADgAuAvgAAQAAAAAAEwApA3sAAwABBAkAAAAsAAAAAwABBAkAAQAWAEUAAwABBAkAAgAOAGkAAwABBAkAAwAWAIEAAwABBAkABAAmAKUAAwABBAkABQAWAOEAAwABBAkABgAWAQUAAwABBAkACAAYASkAAwABBAkACQAYAVAAAwABBAkACgACAXcAAwABBAkACwA0AX0AAwABBAkADAA0Ac4AAwABBAkADQBQAh8AAwABBAkADgBcApoAAwABBAkAEwBSAycAQwBvAHAAeQByAGkAZwBoAHQAIABBAG4AZAByAGUAdwAgAFQAeQBsAGUAcgAAQ29weXJpZ2h0IEFuZHJldyBUeWxlcgAATQBpAG4AZQBjAHIAYQBmAHQAaQBhAABNaW5lY3JhZnRpYQAAUgBlAGcAdQBsAGEAcgAAUmVndWxhcgAATQBpAG4AZQBjAHIAYQBmAHQAaQBhAABNaW5lY3JhZnRpYQAATQBpAG4AZQBjAHIAYQBmAHQAaQBhACAAUgBlAGcAdQBsAGEAcgAATWluZWNyYWZ0aWEgUmVndWxhcgAAVgBlAHIAcwBpAG8AbgAgADEALgAwAABWZXJzaW9uIDEuMAAATQBpAG4AZQBjAHIAYQBmAHQAaQBhAABNaW5lY3JhZnRpYQAAQQBuAGQAcgBlAHcAIABUAHkAbABlAHIAAEFuZHJldyBUeWxlcgAAQQBuAGQAcgBlAHcAIABUAHkAbABlAHIAAEFuZHJldyBUeWxlcgAACgAACgAAaAB0AHQAcAA6AC8ALwB3AHcAdwAuAGEAbgBkAHIAZQB3AHQAeQBsAGUAcgAuAG4AZQB0AABodHRwOi8vd3d3LmFuZHJld3R5bGVyLm5ldAAAaAB0AHQAcAA6AC8ALwB3AHcAdwAuAGEAbgBkAHIAZQB3AHQAeQBsAGUAcgAuAG4AZQB0AABodHRwOi8vd3d3LmFuZHJld3R5bGVyLm5ldAAAQwByAGUAYQB0AGkAdgBlACAAQwBvAG0AbQBvAG4AcwAgAEEAdAB0AHIAaQBiAHUAdABpAG8AbgAgAFMAaABhAHIAZQAgAEEAbABpAGsAZQAAQ3JlYXRpdmUgQ29tbW9ucyBBdHRyaWJ1dGlvbiBTaGFyZSBBbGlrZQAAaAB0AHQAcAA6AC8ALwBjAHIAZQBhAHQAaQB2AGUAYwBvAG0AbQBvAG4AcwAuAG8AcgBnAC8AbABpAGMAZQBuAHMAZQBzAC8AYgB5AC0AcwBhAC8AMwAuADAALwAAaHR0cDovL2NyZWF0aXZlY29tbW9ucy5vcmcvbGljZW5zZXMvYnktc2EvMy4wLwAARgBpAHYAZQAgAGIAaQBnACAAcQB1AGEAYwBrAGkAbgBnACAAegBlAHAAaAB5AHIAcwAgAGoAbwBsAHQAIABtAHkAIAB3AGEAeAAgAGIAZQBkAABGaXZlIGJpZyBxdWFja2luZyB6ZXBoeXJzIGpvbHQgbXkgd2F4IGJlZAAAAAIAAAAAAAAAYgAzAAAAAAAAAAAAAAAAAAAAAAAAAAAA1AAAAQIBAwADAAQABQAGAAcACAAJAAoACwAMAA0ADgAPABAAEQASABMAFAAVABYAFwAYABkAGgAbABwAHQAeAB8AIAAhACIAIwAkACUAJgAnACgAKQAqACsALAAtAC4ALwAwADEAMgAzADQANQA2ADcAOAA5ADoAOwA8AD0APgA/AEAAQQBCAEMARABFAEYARwBIAEkASgBLAEwATQBOAE8AUABRAFIAUwBUAFUAVgBXAFgAWQBaAFsAXABdAF4AXwBgAGEAowCEAIUAvQCWAOgAhgCOAIsAnQCpAKQBBACKANoAgwCTAQUBBgCNAQcAiADDAN4BCACeAKoA9QD0APYAogCtAMkAxwCuAGIAYwCQAGQAywBlAMgAygDPAMwAzQDOAOkAZgDTANAA0QCvAGcA8ACRANYA1ADVAGgA6wDtAIkAagBpAGsAbQBsAG4AoABvAHEAcAByAHMAdQB0AHYAdwDqAHgAegB5AHsAfQB8ALgAoQB/AH4AgACBAOwA7gC6ALsBCQCzALYAtwDEAQoAtAC1AMUAggCHAKsAvgC/AQsAjAEMAQ0GZ2x5cGgxBmdseXBoMgd1bmkwMEFEB3VuaTAwQjIHdW5pMDBCMwd1bmkwMEI1B3VuaTAwQjkHdW5pMUU5RQ1xdW90ZXJldmVyc2VkBEV1cm8HdW5pRkIwMQd1bmlGQjAyAAAAAAH//wACAAEAAAAOAAAAGAAgAAAAAgABAAEA0wABAAQAAAACAAAAAQAAAAEAAAAAAAEAAAAAyYlvMQAAAADK8HqtAAAAAMtPFqk=);
}
.modal-preview-mkcd-minecraft {
  font: 12pt "Minecraftia", sans-serif;
  /* ------- BEGIN bootstrap fixes for the editor ------- */
}
.modal-preview-mkcd-minecraft .ml-25 {
  margin-left: 25px !important;
}
.modal-preview-mkcd-minecraft .minecraft-header {
  background-color: #C6C6C6;
  color: #000000;
}
.modal-preview-mkcd-minecraft .minecraft-options {
  background-color: #414040;
  color: #000000;
}
.modal-preview-mkcd-minecraft button.btn-default {
  border-color: #fff !important;
  background: #404040 !important;
  color: #fff;
  border-radius: 0 !important;
  height: 50px;
  width: 150px;
}
.modal-preview-mkcd-minecraft button.btn-default:hover {
  background: #49507b !important;
}
.modal-preview-mkcd-minecraft button.active {
  background: #c6c6c6 !important;
  border-color: #fff !important;
  color: #000000;
  box-shadow: 0 0 0 0.2rem rgba(37, 107, 156, 0.5) !important;
}
.modal-preview-mkcd-minecraft button.btn-primary {
  background: #c6c6c6 !important;
  border-color: #fff !important;
  color: #000000;
  width: 60px !important;
}
.modal-preview-mkcd-minecraft button.btn-primary:hover {
  background: #c6c6c6 !important;
  border-color: #fff !important;
  color: #000000;
}
.modal-preview-mkcd-minecraft button.btn-primary i:active {
  background: none !important;
  border-color: none !important;
}
.modal-preview-mkcd-minecraft button.btn-primary i:hover {
  background: none !important;
  border-color: none !important;
}
.modal-preview-mkcd-minecraft label {
  font-size: 12px !important;
}
.modal-preview-mkcd-minecraft .popover {
  font: 10pt "Minecraftia", sans-serif;
}
.modal-preview-mkcd-minecraft .popover p {
  margin: 5px;
}
.modal-preview-mkcd-minecraft div[uib-popover-html-popup] {
  width: 450px;
}
.modal-preview-mkcd-minecraft #rendering-img {
  height: calc(100vh - 200px);
  overflow-y: auto;
}
.modal-preview-mkcd-minecraft .monaco-editor {
  width: 100% !important;
  height: 100% !important;
}
.modal-preview-mkcd-minecraft .monaco-editor .container {
  width: auto;
  margin: inherit;
  padding: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .container:before {
  content: "";
  display: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .container:after {
  clear: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .row {
  margin: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .row:before {
  content: "";
  display: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .row:after {
  clear: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .close {
  float: none;
  font-size: inherit;
  font-weight: inherit;
  line-height: inherit;
  color: inherit;
  text-shadow: inherit;
  opacity: inherit;
  filter: inherit;
}
.modal-preview-mkcd-minecraft .monaco-editor .invisible {
  visibility: visible;
}
.modal-preview-mkcd-minecraft .try .drops {
  margin: 0;
  list-style: none;
  float: right;
}
.modal-preview-mkcd-minecraft .try .drops li {
  float: left;
  width: auto;
  height: auto;
  text-indent: 0;
  font-size: 26px;
  line-height: normal;
  margin: 0 12px;
  cursor: pointer;
}
.modal-preview-mkcd-minecraft .try .drops li a:hover {
  text-decoration: none;
}
.modal-preview-mkcd-minecraft .try .drops li a:focus {
  text-decoration: none;
}
.modal-preview-mkcd-minecraft .try .drops li h4 {
  color: #999;
}
.modal-preview-mkcd-minecraft .try .drops li:hover h4 {
  color: rgba(0, 114, 198, 0.5);
}
.modal-preview-mkcd-minecraft .try .drops li.active h4 {
  color: #0072C6;
}
.modal-preview-mkcd-minecraft .try .drops li.active:hover h4 {
  color: #0072C6;
}
.modal-preview-mkcd-minecraft .try .editor.row {
  padding: 18px 0;
}
.modal-preview-mkcd-minecraft .try .editor.row h4 small {
  color: #555;
}
.modal-preview-mkcd-minecraft .try .editor.row .control-label {
  display: inline-block;
  position: relative;
  top: -4px;
  margin-right: 4px;
}
.modal-preview-mkcd-minecraft .try .editor.row .monaco-editor .find-widget input[type=text] {
  margin-bottom: 0;
  box-shadow: none;
  transition: none;
}
.modal-preview-mkcd-minecraft .try .editor.row .monaco-editor .find-widget .monaco-checkbox .label {
  min-height: 20px;
  min-width: 20px;
}
.modal-preview-mkcd-minecraft .try .editor.row .monaco-editor .find-widget .close {
  float: none;
  opacity: 1;
}
.modal-preview-mkcd-minecraft .try .row h4 {
  padding-bottom: 6px;
}
.modal-preview-mkcd-minecraft .try .tile {
  position: relative;
  height: 72px;
  border: 1px solid #ddd;
  text-align: right;
  overflow: hidden;
  cursor: pointer;
  box-shadow: 0 1px 3px rgba(0, 0, 0, 0.055);
  -o-box-sizing: border-box;
  -ms-box-sizing: border-box;
  box-sizing: border-box;
}
.modal-preview-mkcd-minecraft .try .tile:hover {
  box-shadow: 0 1px 5px rgba(0, 0, 0, 0.25);
}
.modal-preview-mkcd-minecraft .try .tile:hover .glyph {
  opacity: 1;
  bottom: -2px;
}
.modal-preview-mkcd-minecraft .try .tile h4 {
  margin: 0;
  position: absolute;
  right: 12px;
  bottom: 12px;
  z-index: 1;
}
.modal-preview-mkcd-minecraft .try .tile .glyph {
  position: absolute;
  left: 12px;
  bottom: -6px;
  background: url("../img/cloud.png") no-repeat;
  background-size: 80px 43px;
  height: 43px;
  width: 80px;
  opacity: 0.5;
  transition: opacity 0.5s ease, bottom 0.5s ease;
  -webkit-transition: opacity 0.5s ease, bottom 0.5s ease;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame {
  position: relative;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame #editor {
  height: 100vh !important;
  margin-bottom: 10px;
  border: 1px solid #eee;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame #editor .alert {
  margin: 18% auto 0;
  width: 30%;
  text-align: center;
  color: #b94a48;
  background-color: #f2dede;
  border-color: #eed3d7;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame #diff-editor {
  height: 100vh !important;
  margin-bottom: 10px;
  border: 1px solid #eee;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame #diff-editor .alert {
  margin: 18% auto 0;
  width: 30%;
  text-align: center;
  color: #b94a48;
  background-color: #f2dede;
  border-color: #eed3d7;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame .loading {
  position: absolute;
  height: 100%;
  width: 100%;
  background-color: rgba(255, 255, 255, 0.5);
  margin: 0 auto;
  display: none;
  z-index: 100;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame .progress {
  width: 50%;
  margin: 15% auto 0;
}
.modal-preview-mkcd-minecraft .try .editor .editor-frame .progress .bar {
  width: 100%;
  background-color: #4bb1cf;
}
.modal-preview-mkcd-minecraft .try .editor #editor .monaco-editor .row {
  margin-left: 0;
}
.modal-preview-mkcd-minecraft .try .editor #diff-editor .monaco-editor .row {
  margin-left: 0;
}
.modal-preview-mkcd-minecraft .try .editor .vs.monaco-editor .context-view.monaco-menu-container a {
  color: #646465;
}
.modal-preview-mkcd-minecraft .try .editor .vs-dark.monaco-editor .context-view.monaco-menu-container a {
  color: #BBB;
}
@media (min-width: 1200px) {
  .modal-preview-mkcd-minecraft .try .editor .row {
    margin-left: 0px;
  }
}
@media (max-width: 767px) {
  .modal-preview-mkcd-minecraft .try .container {
    margin: 0 24px;
  }
  .modal-preview-mkcd-minecraft .try .tile h4 {
    right: 6px;
  }
  .modal-preview-mkcd-minecraft .try .editor > .span9 .row .span4 {
    float: left;
    width: 50%;
  }
  .modal-preview-mkcd-minecraft .try .editor h4 {
    margin-top: 0;
  }
}
@media (max-width: 520px) {
  .modal-preview-mkcd-minecraft .try .editor > .span3 p {
    display: none;
  }
  .modal-preview-mkcd-minecraft .try .editor > .span3 h4 {
    display: none;
  }
}
@media (max-width: 320px) {
  .modal-preview-mkcd-minecraft .try .editor > .span9 {
    display: none;
  }
}

.skillify-image {
  position: absolute;
  top: 50%;
  left: 50%;
  width: 120px;
  height: 120px;
  margin: -60px 0 0 -60px;
  animation: spin 4s linear infinite;
}
@keyframes spin {
  100% {
    transform: rotate(360deg);
  }
}
/** General */
/** End General */
/** Theme Dark */
/** End Theme Dark */
/** Theme Default */
/** End Theme Default */
/** Theme Contrast */
/** End Theme Contrast */
#page-container.teams-teacher {
  background-image: none !important;
  padding-top: 75px !important;
  /** Theme Dark */
  /** End Theme Dark */
  /** Theme Default */
  /** End Theme Default */
  /** Theme Contrast */
  /** End Theme Contrast */
  /** Etiquetas Superior Izquierdo */
  /** End Etiquetas Superior Izquierdo */
}
#page-container.teams-teacher.dark {
  background: #1f1f1f;
  color: #fff;
}
#page-container.teams-teacher.dark h4.text-white {
  color: #fff !important;
}
#page-container.teams-teacher.dark .panel-default > .panel-heading {
  color: #fff;
  background-color: #1f1f1f;
  border-color: #ddd;
}
#page-container.teams-teacher.dark .panel-body {
  background: #1f1f1f !important;
  border: none;
  padding-top: 25px;
  padding-bottom: 0px;
}
#page-container.teams-teacher.dark a:visited {
  color: #fff !important;
}
#page-container.teams-teacher.dark hr {
  background-color: #fff;
}
#page-container.teams-teacher.dark .element {
  background: #292929;
  margin-top: 20px;
  margin-bottom: 30px;
}
#page-container.teams-teacher.dark .alert-dark {
  color: #fff;
  background-color: #282828;
  cursor: pointer;
  overflow: hidden;
  position: relative;
  height: 15em;
  width: 20em;
  margin-bottom: 0px;
  border-top: 1px solid #4C4C4C;
  border-bottom: 1px solid transparent;
  border-left: 1px solid #4C4C4C;
  border-top-left-radius: 6px;
  border-right: 1px solid #4C4C4C;
  border-top-right-radius: 6px;
}
#page-container.teams-teacher.dark .alert-dark-lc {
  margin-top: -30px;
  color: #fff;
  background-color: #282828;
  cursor: pointer;
  width: 20em;
  overflow: hidden;
  position: relative;
  border-bottom: 1px solid #4C4C4C;
  border-left: 1px solid #4C4C4C;
  border-bottom-left-radius: 6px;
  border-right: 1px solid #4C4C4C;
  border-bottom-right-radius: 6px;
  height: 30px;
}
#page-container.teams-teacher.dark .alert-dark-lc p {
  padding-right: 15px;
  padding-bottom: 15px;
  font-size: 8px;
}
#page-container.teams-teacher.dark .alert-dark-cn {
  color: #fff;
  background-color: #282828;
  cursor: pointer;
  border: 1px solid #4C4C4C;
  border-radius: 6px;
  height: 15.8em;
  width: 20em;
}
#page-container.teams-teacher.dark .alert-plus {
  color: #fff;
  background-color: #282828;
  border-color: #4C4C4C;
  margin-left: auto;
}
#page-container.teams-teacher.default {
  background: #fafafa;
  color: #000000;
}
#page-container.teams-teacher.default h4.text-white {
  color: #000000 !important;
}
#page-container.teams-teacher.default .panel-default > .panel-heading {
  color: #000000;
  background-color: #fafafa;
  border-color: #ddd;
}
#page-container.teams-teacher.default .panel-body {
  background: #fafafa !important;
  border: none;
  padding-top: 25px;
  padding-bottom: 0px;
}
#page-container.teams-teacher.default a:visited {
  color: #000000 !important;
}
#page-container.teams-teacher.default hr {
  background-color: #000000;
}
#page-container.teams-teacher.default .element {
  background: #292929;
  margin-top: 20px;
  margin-bottom: 30px;
}
#page-container.teams-teacher.default .alert-dark {
  color: #000000;
  background-color: #eeeeee;
  cursor: pointer;
  overflow: hidden;
  position: relative;
  height: 15em;
  width: 20em;
  margin-bottom: 0px;
  border-top: 1px solid #9E9E9E;
  border-bottom: 1px solid transparent;
  border-left: 1px solid #9E9E9E;
  border-top-left-radius: 6px;
  border-right: 1px solid #9E9E9E;
  border-top-right-radius: 6px;
}
#page-container.teams-teacher.default .alert-dark-lc {
  margin-top: -30px;
  color: #000000;
  background-color: #eeeeee;
  cursor: pointer;
  width: 20em;
  overflow: hidden;
  position: relative;
  border-bottom: 1px solid #9E9E9E;
  border-left: 1px solid #9E9E9E;
  border-bottom-left-radius: 6px;
  border-right: 1px solid #9E9E9E;
  border-bottom-right-radius: 6px;
  height: 30px;
}
#page-container.teams-teacher.default .alert-dark-lc p {
  padding-right: 15px;
  padding-bottom: 15px;
  font-size: 8px;
}
#page-container.teams-teacher.default .alert-dark-cn {
  color: #000000;
  background-color: #eeeeee;
  cursor: pointer;
  border: 1px solid #9E9E9E;
  border-radius: 6px;
  height: 15.8em;
  width: 20em;
}
#page-container.teams-teacher.default .alert-plus {
  color: #000000;
  background-color: #eeeeee;
  border-color: #9E9E9E;
  margin-left: auto;
}
#page-container.teams-teacher.contrast {
  background: #0A0A0A;
  color: #FCFF3C;
}
#page-container.teams-teacher.contrast h4.text-white {
  color: #FCFF3C !important;
}
#page-container.teams-teacher.contrast .panel-default > .panel-heading {
  color: #FCFF3C;
  background-color: #0A0A0A;
  border-color: #ddd;
}
#page-container.teams-teacher.contrast .panel-body {
  background: #0A0A0A !important;
  border: none;
  padding-top: 25px;
  padding-bottom: 0px;
}
#page-container.teams-teacher.contrast a:visited {
  color: #FCFF3C !important;
}
#page-container.teams-teacher.contrast hr {
  background-color: #FCFF3C;
}
#page-container.teams-teacher.contrast .element {
  background: #292929;
  margin-top: 20px;
  margin-bottom: 30px;
}
#page-container.teams-teacher.contrast .alert-dark {
  color: #FCFF3C;
  background-color: #282828;
  cursor: pointer;
  overflow: hidden;
  position: relative;
  height: 15em;
  width: 20em;
  margin-bottom: 0px;
  border-top: 1px solid #B5B0B0;
  border-bottom: 1px solid transparent;
  border-left: 1px solid #B5B0B0;
  border-top-left-radius: 6px;
  border-right: 1px solid #B5B0B0;
  border-top-right-radius: 6px;
}
#page-container.teams-teacher.contrast .alert-dark-lc {
  margin-top: -30px;
  color: #FCFF3C;
  background-color: #282828;
  cursor: pointer;
  width: 20em;
  overflow: hidden;
  position: relative;
  border-bottom: 1px solid #B5B0B0;
  border-left: 1px solid #B5B0B0;
  border-bottom-left-radius: 6px;
  border-right: 1px solid #B5B0B0;
  border-bottom-right-radius: 6px;
  height: 30px;
}
#page-container.teams-teacher.contrast .alert-dark-lc p {
  padding-right: 15px;
  padding-bottom: 15px;
  font-size: 8px;
}
#page-container.teams-teacher.contrast .alert-dark-cn {
  color: #FCFF3C;
  background-color: #282828;
  cursor: pointer;
  border: 1px solid #B5B0B0;
  border-radius: 6px;
  height: 15.8em;
  width: 20em;
}
#page-container.teams-teacher.contrast .alert-plus {
  color: #FCFF3C;
  background-color: #282828;
  border-color: #B5B0B0;
  margin-left: auto;
}
#page-container.teams-teacher .panel-group {
  border: none;
}
#page-container.teams-teacher .panel-default {
  border: none;
}
#page-container.teams-teacher h4.panel-title {
  font-size: 12px;
}
#page-container.teams-teacher .teacher-area {
  margin-left: 30px;
  margin-right: 30px;
}
#page-container.teams-teacher .purple-title {
  color: #7276d0 !important;
}
#page-container.teams-teacher .green-title {
  color: #56812e !important;
}
#page-container.teams-teacher .alert-dark > .content {
  height: 100px;
}
#page-container.teams-teacher .alert-plus {
  background-color: #767676;
  width: 70px;
  height: 70px;
  border-color: #0A0A0A;
  border-radius: 15px;
}
#page-container.teams-teacher .alert-plus .fa {
  color: #0A0A0A;
}
#page-container.teams-teacher .alert-plus .fa-lg {
  font-size: 5em !important;
}
#page-container.teams-teacher .alert-plus p {
  color: #F0F0F0;
  font-size: 14px;
}
#page-container.teams-teacher .container {
  position: relative;
}
#page-container.teams-teacher .text-block {
  color: white;
  position: relative;
  top: -35px;
  left: 10px;
  font-weight: bold;
  padding: 0px;
  transform: rotate(-45deg);
}
#page-container.teams-teacher .delete-content {
  float: right !important;
}
#page-container.teams-teacher .fa-specific-size {
  font-size: 1.2em;
  color: #867F7F;
}
#page-container.teams-teacher .square-size {
  margin-left: 32%;
  width: 70px;
  height: 70px;
  border-radius: 6px;
}
#page-container.teams-teacher .plus-sign-content {
  font-size: 3.5em !important;
  font-weight: 600 !important;
}
#page-container.teams-teacher .label-course {
  transform: rotate(-45deg);
  position: absolute;
  left: -118px;
  color: #FFF;
  font-weight: bold;
  box-shadow: 0px 2px 3px rgba(136, 136, 136, 0.25) !important;
  background: #21BF38 !important;
  height: 15px;
  text-align: center;
  width: 275px;
  font-size: 8px;
  top: 7px;
}
#page-container.teams-teacher .label-course label {
  margin-top: -0.3rem;
  position: absolute;
  margin-left: -2em;
}
#page-container.teams-teacher .label-test {
  transform: rotate(-45deg);
  position: absolute;
  left: -118px;
  color: #FFF;
  font-weight: bold;
  box-shadow: 0px 2px 3px rgba(136, 136, 136, 0.25) !important;
  background: #8C592B !important;
  height: 15px;
  text-align: center;
  width: 275px;
  font-size: 8px;
  top: 7px;
}
#page-container.teams-teacher .label-test label {
  margin-top: -0.3rem;
  position: absolute;
  margin-left: -1.1rem;
}

.current-filter {
  display: inline !important;
}

.filter-name {
  border-top-right-radius: 0px !important;
  border-bottom-right-radius: 0px !important;
}

.delete-filter {
  border-top-left-radius: 0px !important;
  border-bottom-left-radius: 0px !important;
  cursor: pointer;
}

.hide-filter {
  display: none !important;
}

.show-filter {
  display: block !important;
}

#floating-filters {
  position: fixed;
  width: 100%;
  height: 100%;
  top: 0;
  left: 0;
  right: 0;
  bottom: 0;
  background-color: rgba(0, 0, 0, 0.77);
  z-index: 1000000;
}
#floating-filters .options {
  background: #fff;
  bottom: 0;
  min-height: 90vh;
  position: absolute;
  right: 0;
  top: 0;
  width: 25%;
  overflow-y: auto;
  overflow-x: hidden;
  scrollbar-gutter: stable;
  scrollbar-color: rgba(58, 58, 58, 0.41);
  scrollbar-width: thin;
}
#floating-filters .options .body-filter {
  margin: 0 auto;
  padding: 15px;
  flex-shrink: 1;
  min-height: 86vh;
}
#floating-filters .options .fixed-header, #floating-filters .options .fixed-footer {
  padding: 10px 0;
  color: #000;
  font-size: 16px;
}
#floating-filters .options .fixed-header {
  top: 0;
}
#floating-filters .options .fixed-footer {
  bottom: 0;
}

@media (max-width: 1272px) {
  #floating-filters .options .body-filter {
    min-height: auto !important;
    padding: 5px;
  }
}
.filter-dropdown {
  width: 100% !important;
}
.filter-dropdown .select2-dropdown {
  z-index: 10000000 !important;
}